Incidental Mutation 'R8382:Olfr975'
ID646986
Institutional Source Beutler Lab
Gene Symbol Olfr975
Ensembl Gene ENSMUSG00000043331
Gene Nameolfactory receptor 975
SynonymsMOR224-2, GA_x6K02T2PVTD-33651220-33650288
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8382 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39948131-39952046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39950159 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 204 (V204A)
Ref Sequence ENSEMBL: ENSMUSP00000150664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054067] [ENSMUST00000169307] [ENSMUST00000213171] [ENSMUST00000213246] [ENSMUST00000216647] [ENSMUST00000217630]
Predicted Effect probably benign
Transcript: ENSMUST00000054067
AA Change: V204A

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000059776
Gene: ENSMUSG00000043331
AA Change: V204A

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.9e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 249 1.8e-7 PFAM
Pfam:7tm_1 39 286 3.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169307
SMART Domains Protein: ENSMUSP00000133083
Gene: ENSMUSG00000047352

DomainStartEndE-ValueType
Pfam:7tm_4 43 318 1.5e-48 PFAM
Pfam:7TM_GPCR_Srsx 47 271 1.1e-5 PFAM
Pfam:7tm_1 53 300 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213171
Predicted Effect probably benign
Transcript: ENSMUST00000213246
Predicted Effect probably benign
Transcript: ENSMUST00000216647
AA Change: V204A

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000217630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,560,682 R689G probably benign Het
Atg9a G A 1: 75,185,698 Q523* probably null Het
Cacna1i G A 15: 80,376,816 V1342M probably damaging Het
Ccdc87 A G 19: 4,839,990 D170G possibly damaging Het
Cpsf1 A G 15: 76,600,951 V541A probably benign Het
Depdc5 C T 5: 32,927,898 T687M probably benign Het
Ear6 T C 14: 51,854,113 I39T probably damaging Het
Fam155a T C 8: 9,207,972 E392G probably benign Het
Fcgbp C T 7: 28,117,337 A2408V probably benign Het
Frmd4b G A 6: 97,305,248 T539I probably benign Het
Gif A T 19: 11,749,726 T100S probably benign Het
Gm19410 T A 8: 35,809,148 V1653D probably damaging Het
Gm906 T C 13: 50,247,438 K284R possibly damaging Het
Kncn A G 4: 115,886,750 N75S probably benign Het
Lig4 C T 8: 9,972,346 G478D probably damaging Het
Med24 G A 11: 98,717,711 T205I unknown Het
Meiob A G 17: 24,827,939 E179G possibly damaging Het
Olfr1197 A T 2: 88,729,513 F29I probably damaging Het
Olfr907 A T 9: 38,499,292 I208F probably damaging Het
Pcdh15 T C 10: 74,643,395 V708A probably benign Het
Pclo T A 5: 14,677,066 D1979E unknown Het
Plxnd1 A T 6: 115,972,472 H784Q probably benign Het
Rnf17 TG T 14: 56,424,542 probably null Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,917 probably benign Het
Slc7a5 A T 8: 121,885,952 I371N probably damaging Het
Taf1c G T 8: 119,603,050 D117E probably damaging Het
Tekt5 T C 16: 10,395,064 D119G probably benign Het
Top3b T C 16: 16,888,003 I508T probably damaging Het
Uba6 A G 5: 86,131,337 I673T probably benign Het
Vmn2r17 G T 5: 109,428,521 M419I probably benign Het
Zfr C T 15: 12,152,968 Q562* probably null Het
Zfyve16 A T 13: 92,513,820 D885E probably benign Het
Other mutations in Olfr975
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Olfr975 APN 9 39949988 missense probably benign 0.01
IGL01537:Olfr975 APN 9 39950625 missense probably benign 0.00
IGL01963:Olfr975 APN 9 39950240 missense probably damaging 1.00
IGL02400:Olfr975 APN 9 39950339 missense probably benign
IGL03115:Olfr975 APN 9 39950744 missense probably damaging 0.98
IGL03226:Olfr975 APN 9 39950423 splice site probably null
R0088:Olfr975 UTSW 9 39950375 missense probably benign 0.03
R0212:Olfr975 UTSW 9 39949940 missense probably benign 0.44
R1668:Olfr975 UTSW 9 39950169 missense possibly damaging 0.94
R1878:Olfr975 UTSW 9 39950757 missense probably benign 0.35
R2225:Olfr975 UTSW 9 39950537 missense possibly damaging 0.84
R2291:Olfr975 UTSW 9 39950334 missense probably benign 0.19
R2420:Olfr975 UTSW 9 39950528 missense possibly damaging 0.47
R2421:Olfr975 UTSW 9 39950528 missense possibly damaging 0.47
R2422:Olfr975 UTSW 9 39950528 missense possibly damaging 0.47
R2425:Olfr975 UTSW 9 39949841 missense probably null 0.25
R2918:Olfr975 UTSW 9 39950364 missense probably benign
R4536:Olfr975 UTSW 9 39950435 missense probably damaging 1.00
R4709:Olfr975 UTSW 9 39949869 missense probably damaging 0.97
R4831:Olfr975 UTSW 9 39950112 missense probably benign 0.01
R4921:Olfr975 UTSW 9 39950225 missense probably damaging 0.98
R5113:Olfr975 UTSW 9 39949925 missense probably damaging 0.99
R5141:Olfr975 UTSW 9 39949874 missense probably benign 0.07
R5195:Olfr975 UTSW 9 39950679 missense probably benign
R5213:Olfr975 UTSW 9 39950093 missense probably damaging 0.99
R5568:Olfr975 UTSW 9 39950687 missense probably benign 0.05
R6993:Olfr975 UTSW 9 39950637 missense probably benign
R7080:Olfr975 UTSW 9 39950148 missense probably damaging 1.00
R7436:Olfr975 UTSW 9 39950053 nonsense probably null
R8178:Olfr975 UTSW 9 39950412 missense probably benign 0.05
R8179:Olfr975 UTSW 9 39950412 missense probably benign 0.05
R8402:Olfr975 UTSW 9 39950417 missense probably benign 0.39
R8511:Olfr975 UTSW 9 39950159 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CTGAATCCAGCCAAGGACTG -3'
(R):5'- TCACCCTTTGAGGTACACAGTC -3'

Sequencing Primer
(F):5'- GGACTGGAGGCAGGTCTG -3'
(R):5'- CACAGTCATAATGAGTTCATGGGTG -3'
Posted On2020-09-02