Incidental Mutation 'R0041:Rnf220'
ID64701
Institutional Source Beutler Lab
Gene Symbol Rnf220
Ensembl Gene ENSMUSG00000028677
Gene Namering finger protein 220
Synonyms
MMRRC Submission 038335-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.775) question?
Stock #R0041 (G1)
Quality Score104
Status Validated
Chromosome4
Chromosomal Location117271463-117497052 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117273284 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 293 (L293P)
Ref Sequence ENSEMBL: ENSMUSP00000092449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030439] [ENSMUST00000062824] [ENSMUST00000094853] [ENSMUST00000102690] [ENSMUST00000106433] [ENSMUST00000106434] [ENSMUST00000125943] [ENSMUST00000221654]
Predicted Effect probably damaging
Transcript: ENSMUST00000030439
AA Change: L506P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030439
Gene: ENSMUSG00000028677
AA Change: L506P

DomainStartEndE-ValueType
Pfam:RNF220 217 339 3.5e-38 PFAM
Pfam:RNF220 325 444 4.9e-51 PFAM
RING 514 552 1.62e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000062824
SMART Domains Protein: ENSMUSP00000061523
Gene: ENSMUSG00000048772

DomainStartEndE-ValueType
Pfam:DUF829 34 270 4.1e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000094853
AA Change: L293P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092449
Gene: ENSMUSG00000028677
AA Change: L293P

DomainStartEndE-ValueType
low complexity region 176 187 N/A INTRINSIC
RING 301 339 1.62e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102690
AA Change: L185P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099751
Gene: ENSMUSG00000028677
AA Change: L185P

DomainStartEndE-ValueType
low complexity region 68 79 N/A INTRINSIC
RING 193 231 1.62e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106433
SMART Domains Protein: ENSMUSP00000102041
Gene: ENSMUSG00000048772

DomainStartEndE-ValueType
Pfam:DUF829 19 255 3.4e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106434
SMART Domains Protein: ENSMUSP00000102042
Gene: ENSMUSG00000048772

DomainStartEndE-ValueType
Pfam:DUF829 41 277 1.3e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125943
SMART Domains Protein: ENSMUSP00000121458
Gene: ENSMUSG00000048772

DomainStartEndE-ValueType
Pfam:DUF829 19 252 5.3e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128122
SMART Domains Protein: ENSMUSP00000114642
Gene: ENSMUSG00000028677

DomainStartEndE-ValueType
low complexity region 94 105 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145836
Predicted Effect probably benign
Transcript: ENSMUST00000151829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221157
Predicted Effect probably damaging
Transcript: ENSMUST00000221654
AA Change: L248P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223371
Meta Mutation Damage Score 0.1343 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Avpi1 C A 19: 42,123,784 E112* probably null Het
Braf C T 6: 39,640,479 A534T probably damaging Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cdhr2 A T 13: 54,726,838 S908C probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Efna5 A T 17: 62,607,472 probably benign Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Galnt4 A G 10: 99,108,512 Y33C probably benign Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Krt71 C A 15: 101,739,318 E222D probably damaging Het
Ltf T A 9: 111,029,568 D461E possibly damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfml1 A T 7: 107,590,186 I153L possibly damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Olfr954 T A 9: 39,461,476 F12Y probably benign Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Peg12 T A 7: 62,463,560 E263V unknown Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rlf T A 4: 121,149,929 H618L probably damaging Het
Rnf112 T A 11: 61,452,355 R165W probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rock1 T C 18: 10,140,240 D117G probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Rpl7a A G 2: 26,911,551 probably null Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Swap70 A G 7: 110,279,355 K511E probably benign Het
Treh T C 9: 44,683,613 V262A probably benign Het
Trpm4 A G 7: 45,304,946 probably null Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Wdr64 G A 1: 175,726,471 W189* probably null Het
Other mutations in Rnf220
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Rnf220 APN 4 117307675 missense probably benign 0.02
IGL01345:Rnf220 APN 4 117273270 nonsense probably null
IGL02097:Rnf220 APN 4 117273327 missense probably benign 0.00
IGL02245:Rnf220 APN 4 117299537 splice site probably benign
IGL02366:Rnf220 APN 4 117489783 missense probably benign
IGL02725:Rnf220 APN 4 117272379 splice site probably benign
IGL02801:Rnf220 APN 4 117273251 missense probably damaging 1.00
IGL02963:Rnf220 APN 4 117490192 missense probably damaging 0.97
PIT4131001:Rnf220 UTSW 4 117277369 critical splice donor site probably null
R0784:Rnf220 UTSW 4 117277998 splice site probably benign
R1107:Rnf220 UTSW 4 117285390 missense probably damaging 1.00
R1122:Rnf220 UTSW 4 117278080 missense probably benign 0.01
R1231:Rnf220 UTSW 4 117489884 missense probably damaging 0.98
R1708:Rnf220 UTSW 4 117489886 missense probably benign 0.00
R1794:Rnf220 UTSW 4 117307568 missense probably benign
R4488:Rnf220 UTSW 4 117489814 missense probably damaging 1.00
R4710:Rnf220 UTSW 4 117289214 unclassified probably benign
R4790:Rnf220 UTSW 4 117289055 missense probably benign 0.45
R4923:Rnf220 UTSW 4 117489600 missense possibly damaging 0.71
R5173:Rnf220 UTSW 4 117289274 start gained probably benign
R5334:Rnf220 UTSW 4 117272351 missense probably damaging 1.00
R5505:Rnf220 UTSW 4 117296091 intron probably benign
R5849:Rnf220 UTSW 4 117277612 missense possibly damaging 0.92
R7075:Rnf220 UTSW 4 117285882 missense probably benign 0.28
R7349:Rnf220 UTSW 4 117277818 missense probably damaging 0.99
R7478:Rnf220 UTSW 4 117296136 missense possibly damaging 0.94
R7541:Rnf220 UTSW 4 117489930 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATGCCAACACTGGATCGACG -3'
(R):5'- TTGCCAAGCACCTGCCTTAGATAC -3'

Sequencing Primer
(F):5'- CGTCAGAGGCATCGAGTAAG -3'
(R):5'- TAGCTCTCCCCTGGGAGTG -3'
Posted On2013-08-06