Incidental Mutation 'R8383:Alpk1'
ID647011
Institutional Source Beutler Lab
Gene Symbol Alpk1
Ensembl Gene ENSMUSG00000028028
Gene Namealpha-kinase 1
Synonyms8430410J10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8383 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location127670310-127780527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 127724436 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 72 (M72K)
Ref Sequence ENSEMBL: ENSMUSP00000029662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029662] [ENSMUST00000198955]
Predicted Effect probably benign
Transcript: ENSMUST00000029662
AA Change: M72K

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029662
Gene: ENSMUSG00000028028
AA Change: M72K

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198955
AA Change: M72K

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143223
Gene: ENSMUSG00000028028
AA Change: M72K

DomainStartEndE-ValueType
low complexity region 85 97 N/A INTRINSIC
low complexity region 618 628 N/A INTRINSIC
low complexity region 700 714 N/A INTRINSIC
low complexity region 902 914 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Alpha_kinase 1008 1215 1.03e-81 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an alpha kinase. Mice which were homozygous for disrupted copies of this gene exhibited coordination defects (PMID: 21208416). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A T 5: 121,607,373 M285K probably damaging Het
Adcyap1r1 T C 6: 55,480,000 S239P probably damaging Het
Alpk2 G T 18: 65,305,398 R975S probably benign Het
Ankrd7 A T 6: 18,868,411 K177N possibly damaging Het
Asxl1 A G 2: 153,393,719 T272A probably damaging Het
Ccdc175 A G 12: 72,109,178 Y666H possibly damaging Het
Cyp2j11 T C 4: 96,348,458 N37S probably benign Het
Dglucy A G 12: 100,835,329 D81G probably benign Het
Dysf T A 6: 84,019,583 D22E probably damaging Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm3415 C T 5: 146,558,418 P210L probably benign Het
Gm7995 A G 14: 42,311,364 H66R Het
Habp2 G A 19: 56,316,336 V388M probably damaging Het
Hey2 A G 10: 30,840,669 S33P probably benign Het
Hmbs C T 9: 44,337,943 R195H probably damaging Het
Hrnr A T 3: 93,332,346 Y3297F unknown Het
Hspg2 T A 4: 137,544,370 H2482Q possibly damaging Het
Ifi207 GAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG GGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,729,204 probably benign Het
Ifi208 T A 1: 173,683,509 V410E possibly damaging Het
Igkv3-7 A G 6: 70,607,750 T25A probably damaging Het
Il22ra1 A G 4: 135,734,140 Q72R probably damaging Het
Ip6k1 T A 9: 108,044,727 F207I possibly damaging Het
Kdm6b A G 11: 69,406,050 S464P probably benign Het
Kirrel3 G T 9: 35,029,883 M601I probably null Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Kmt2e A G 5: 23,485,541 N518S probably benign Het
Myo5b A G 18: 74,643,978 S370G probably benign Het
Nrn1l T C 8: 105,894,426 L50P probably damaging Het
Nrxn2 A G 19: 6,472,313 Y411C probably damaging Het
Obsl1 G T 1: 75,503,857 F374L possibly damaging Het
Olfr1093 A G 2: 86,786,530 I267V probably benign Het
Olfr344 A T 2: 36,569,002 I135F probably benign Het
Olfr352 A G 2: 36,870,331 Y255C probably damaging Het
Panx3 T A 9: 37,666,753 probably null Het
Piezo2 A T 18: 63,084,688 F1139L probably damaging Het
Pld2 G A 11: 70,551,429 D380N possibly damaging Het
Plekha7 A C 7: 116,144,919 N715K probably damaging Het
Pom121l12 T A 11: 14,599,353 S20T probably benign Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rdh8 G A 9: 20,822,785 probably null Het
Rgl3 G A 9: 21,977,233 T427I probably damaging Het
Rnf17 TG T 14: 56,424,542 probably null Het
Sclt1 A C 3: 41,742,015 I5S probably benign Het
Seh1l A G 18: 67,775,056 H16R possibly damaging Het
Sgca G A 11: 94,972,242 P95L probably benign Het
Spag17 T G 3: 100,085,392 S1735A probably damaging Het
Tdrd3 T C 14: 87,506,308 I564T probably benign Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 11: 94,214,377 probably benign Het
Trpv3 T G 11: 73,289,301 F524V probably benign Het
Ttc41 A G 10: 86,719,526 N282S probably benign Het
Txnrd2 T C 16: 18,472,864 L421P possibly damaging Het
Tyr A T 7: 87,483,992 C289S probably damaging Het
Ubn1 A G 16: 5,077,358 E756G possibly damaging Het
Vps13a A T 19: 16,723,705 M700K possibly damaging Het
Zfhx2 A G 14: 55,074,071 S389P possibly damaging Het
Zfp667 T C 7: 6,305,371 L346P probably damaging Het
Zfp945 A G 17: 22,851,824 M388T probably benign Het
Zfp992 A G 4: 146,466,676 I285V probably benign Het
Other mutations in Alpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Alpk1 APN 3 127681043 missense probably damaging 1.00
IGL00722:Alpk1 APN 3 127680213 missense probably benign 0.00
IGL01066:Alpk1 APN 3 127680225 missense probably benign 0.22
IGL01351:Alpk1 APN 3 127672362 missense probably damaging 0.97
IGL01412:Alpk1 APN 3 127679972 missense possibly damaging 0.60
IGL01469:Alpk1 APN 3 127677752 splice site probably null
IGL01585:Alpk1 APN 3 127679813 missense probably benign 0.01
IGL02308:Alpk1 APN 3 127729282 missense probably damaging 0.99
IGL02325:Alpk1 APN 3 127679903 missense probably benign 0.43
IGL02458:Alpk1 APN 3 127681319 critical splice donor site probably null
IGL02553:Alpk1 APN 3 127673321 missense probably damaging 1.00
IGL02717:Alpk1 APN 3 127681100 missense possibly damaging 0.76
IGL02729:Alpk1 APN 3 127681072 missense possibly damaging 0.87
IGL02832:Alpk1 APN 3 127679943 missense possibly damaging 0.63
IGL02892:Alpk1 APN 3 127680122 missense possibly damaging 0.92
IGL03178:Alpk1 APN 3 127680221 nonsense probably null
R0427:Alpk1 UTSW 3 127671071 missense probably damaging 1.00
R0981:Alpk1 UTSW 3 127679402 missense possibly damaging 0.62
R1174:Alpk1 UTSW 3 127680810 missense probably damaging 0.99
R1793:Alpk1 UTSW 3 127677798 missense probably damaging 1.00
R1859:Alpk1 UTSW 3 127681100 missense possibly damaging 0.76
R2173:Alpk1 UTSW 3 127683590 missense probably damaging 1.00
R2235:Alpk1 UTSW 3 127680920 missense probably benign 0.01
R2373:Alpk1 UTSW 3 127679808 missense probably benign 0.00
R3803:Alpk1 UTSW 3 127679837 missense possibly damaging 0.93
R3927:Alpk1 UTSW 3 127677716 missense probably damaging 1.00
R4356:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4357:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4358:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4379:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4381:Alpk1 UTSW 3 127729373 missense probably damaging 0.98
R4470:Alpk1 UTSW 3 127679526 missense probably damaging 1.00
R4471:Alpk1 UTSW 3 127679526 missense probably damaging 1.00
R4473:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4474:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4476:Alpk1 UTSW 3 127680018 missense probably damaging 0.97
R4512:Alpk1 UTSW 3 127684471 intron probably benign
R4594:Alpk1 UTSW 3 127683554 missense probably damaging 1.00
R4678:Alpk1 UTSW 3 127679858 missense probably damaging 0.99
R4707:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4784:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4785:Alpk1 UTSW 3 127687592 missense possibly damaging 0.50
R4820:Alpk1 UTSW 3 127671059 missense probably benign 0.06
R4887:Alpk1 UTSW 3 127673475 missense probably damaging 1.00
R5088:Alpk1 UTSW 3 127685320 splice site probably benign
R5169:Alpk1 UTSW 3 127671101 missense probably damaging 1.00
R5280:Alpk1 UTSW 3 127681164 missense probably benign 0.00
R5351:Alpk1 UTSW 3 127729292 missense probably damaging 0.96
R5478:Alpk1 UTSW 3 127677719 missense probably damaging 1.00
R5627:Alpk1 UTSW 3 127680647 missense probably damaging 0.99
R5781:Alpk1 UTSW 3 127680035 missense possibly damaging 0.92
R5842:Alpk1 UTSW 3 127680969 missense probably damaging 1.00
R5847:Alpk1 UTSW 3 127680074 missense probably benign 0.06
R5940:Alpk1 UTSW 3 127670946 missense probably benign
R6187:Alpk1 UTSW 3 127673342 missense probably damaging 1.00
R6306:Alpk1 UTSW 3 127686316 missense probably damaging 1.00
R6414:Alpk1 UTSW 3 127680209 missense probably benign
R6701:Alpk1 UTSW 3 127729336 missense probably damaging 1.00
R6735:Alpk1 UTSW 3 127724449 missense probably damaging 1.00
R6850:Alpk1 UTSW 3 127729363 missense possibly damaging 0.87
R7173:Alpk1 UTSW 3 127684375 nonsense probably null
R7258:Alpk1 UTSW 3 127724466 missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127672494 missense probably damaging 1.00
R7412:Alpk1 UTSW 3 127695733 missense probably damaging 1.00
R7498:Alpk1 UTSW 3 127679778 missense probably benign 0.22
R7635:Alpk1 UTSW 3 127695661 missense probably benign 0.01
R7660:Alpk1 UTSW 3 127680967 missense probably damaging 1.00
R7682:Alpk1 UTSW 3 127672546 missense possibly damaging 0.94
R7732:Alpk1 UTSW 3 127684392 missense
R7827:Alpk1 UTSW 3 127680051 missense probably benign 0.00
R8029:Alpk1 UTSW 3 127729285 missense possibly damaging 0.95
Z1176:Alpk1 UTSW 3 127673438 missense probably damaging 1.00
Z1177:Alpk1 UTSW 3 127685307 missense
Predicted Primers PCR Primer
(F):5'- GCAGGGGCTATCTTGTACTTC -3'
(R):5'- ATTCTTCAAGGCAGCTCCCAAC -3'

Sequencing Primer
(F):5'- CAGAGAAATTTAATCTGTGAGACCAC -3'
(R):5'- AGCTACTGAGGTGCTTCATC -3'
Posted On2020-09-02