Incidental Mutation 'R8383:Klk1b1'
ID647025
Institutional Source Beutler Lab
Gene Symbol Klk1b1
Ensembl Gene ENSMUSG00000063133
Gene Namekallikrein 1-related peptidase b1
SynonymsmGK-1, tissue kallikrein, TK, Klk1, mK1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R8383 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location43966751-43971318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43970343 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 109 (R109C)
Ref Sequence ENSEMBL: ENSMUSP00000077879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078835]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078835
AA Change: R109C

PolyPhen 2 Score 0.858 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077879
Gene: ENSMUSG00000063133
AA Change: R109C

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 1.25e-98 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of serine proteases that are involved in diverse physiological functions such as skin desquamation, tooth enamel formation, seminal liquefaction, synaptic neural plasticity and brain function. The encoded preproprotein undergoes proteolytic cleavage of the activation peptide to generate the functional enzyme. This gene is located in a cluster of several related kallikrein genes on chromosome 7. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice display decreased left ventricular contractility, cardiac output, and stroke volume, a thin left ventricular wall, and impaired vasodilation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A T 5: 121,607,373 M285K probably damaging Het
Adcyap1r1 T C 6: 55,480,000 S239P probably damaging Het
Alpk1 A T 3: 127,724,436 M72K probably benign Het
Alpk2 G T 18: 65,305,398 R975S probably benign Het
Ankrd7 A T 6: 18,868,411 K177N possibly damaging Het
Asxl1 A G 2: 153,393,719 T272A probably damaging Het
Ccdc175 A G 12: 72,109,178 Y666H possibly damaging Het
Cyp2j11 T C 4: 96,348,458 N37S probably benign Het
Dglucy A G 12: 100,835,329 D81G probably benign Het
Dysf T A 6: 84,019,583 D22E probably damaging Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm3415 C T 5: 146,558,418 P210L probably benign Het
Gm7995 A G 14: 42,311,364 H66R Het
Habp2 G A 19: 56,316,336 V388M probably damaging Het
Hey2 A G 10: 30,840,669 S33P probably benign Het
Hmbs C T 9: 44,337,943 R195H probably damaging Het
Hrnr A T 3: 93,332,346 Y3297F unknown Het
Hspg2 T A 4: 137,544,370 H2482Q possibly damaging Het
Ifi207 GAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG GGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,729,204 probably benign Het
Ifi208 T A 1: 173,683,509 V410E possibly damaging Het
Igkv3-7 A G 6: 70,607,750 T25A probably damaging Het
Il22ra1 A G 4: 135,734,140 Q72R probably damaging Het
Ip6k1 T A 9: 108,044,727 F207I possibly damaging Het
Kdm6b A G 11: 69,406,050 S464P probably benign Het
Kirrel3 G T 9: 35,029,883 M601I probably null Het
Kmt2e A G 5: 23,485,541 N518S probably benign Het
Myo5b A G 18: 74,643,978 S370G probably benign Het
Nrn1l T C 8: 105,894,426 L50P probably damaging Het
Nrxn2 A G 19: 6,472,313 Y411C probably damaging Het
Obsl1 G T 1: 75,503,857 F374L possibly damaging Het
Olfr1093 A G 2: 86,786,530 I267V probably benign Het
Olfr344 A T 2: 36,569,002 I135F probably benign Het
Olfr352 A G 2: 36,870,331 Y255C probably damaging Het
Panx3 T A 9: 37,666,753 probably null Het
Piezo2 A T 18: 63,084,688 F1139L probably damaging Het
Pld2 G A 11: 70,551,429 D380N possibly damaging Het
Plekha7 A C 7: 116,144,919 N715K probably damaging Het
Pom121l12 T A 11: 14,599,353 S20T probably benign Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rdh8 G A 9: 20,822,785 probably null Het
Rgl3 G A 9: 21,977,233 T427I probably damaging Het
Rnf17 TG T 14: 56,424,542 probably null Het
Sclt1 A C 3: 41,742,015 I5S probably benign Het
Seh1l A G 18: 67,775,056 H16R possibly damaging Het
Sgca G A 11: 94,972,242 P95L probably benign Het
Spag17 T G 3: 100,085,392 S1735A probably damaging Het
Tdrd3 T C 14: 87,506,308 I564T probably benign Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 11: 94,214,377 probably benign Het
Trpv3 T G 11: 73,289,301 F524V probably benign Het
Ttc41 A G 10: 86,719,526 N282S probably benign Het
Txnrd2 T C 16: 18,472,864 L421P possibly damaging Het
Tyr A T 7: 87,483,992 C289S probably damaging Het
Ubn1 A G 16: 5,077,358 E756G possibly damaging Het
Vps13a A T 19: 16,723,705 M700K possibly damaging Het
Zfhx2 A G 14: 55,074,071 S389P possibly damaging Het
Zfp667 T C 7: 6,305,371 L346P probably damaging Het
Zfp945 A G 17: 22,851,824 M388T probably benign Het
Zfp992 A G 4: 146,466,676 I285V probably benign Het
Other mutations in Klk1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Klk1b1 APN 7 43971169 missense possibly damaging 0.83
IGL02794:Klk1b1 APN 7 43970365 missense possibly damaging 0.62
IGL03266:Klk1b1 APN 7 43970476 missense probably benign 0.18
R0324:Klk1b1 UTSW 7 43970741 nonsense probably null
R0689:Klk1b1 UTSW 7 43970719 missense probably benign
R1552:Klk1b1 UTSW 7 43969343 missense probably damaging 1.00
R1697:Klk1b1 UTSW 7 43970326 missense probably benign 0.01
R1737:Klk1b1 UTSW 7 43970359 missense probably benign 0.01
R2060:Klk1b1 UTSW 7 43970623 missense possibly damaging 0.73
R2159:Klk1b1 UTSW 7 43970433 missense probably damaging 0.97
R2177:Klk1b1 UTSW 7 43969271 missense possibly damaging 0.63
R2213:Klk1b1 UTSW 7 43970481 missense probably damaging 1.00
R2509:Klk1b1 UTSW 7 43969379 missense probably damaging 1.00
R2510:Klk1b1 UTSW 7 43969379 missense probably damaging 1.00
R3849:Klk1b1 UTSW 7 43969327 missense probably damaging 1.00
R5567:Klk1b1 UTSW 7 43971169 missense probably damaging 0.99
R6191:Klk1b1 UTSW 7 43970657 missense probably damaging 1.00
R7162:Klk1b1 UTSW 7 43969247 missense probably damaging 0.99
R7535:Klk1b1 UTSW 7 43970322 missense probably damaging 1.00
R7752:Klk1b1 UTSW 7 43971245 missense probably damaging 1.00
R7901:Klk1b1 UTSW 7 43971245 missense probably damaging 1.00
R8320:Klk1b1 UTSW 7 43970343 missense possibly damaging 0.86
R8379:Klk1b1 UTSW 7 43970343 missense possibly damaging 0.86
R8381:Klk1b1 UTSW 7 43970343 missense possibly damaging 0.86
R8511:Klk1b1 UTSW 7 43970343 missense possibly damaging 0.86
X0012:Klk1b1 UTSW 7 43970659 missense probably benign 0.05
Z1088:Klk1b1 UTSW 7 43970401 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACAGACCTGTCCTAGCTGC -3'
(R):5'- TGCTTGGACCAGACTCACAC -3'

Sequencing Primer
(F):5'- TGAGCAGCTCTCAGGTCTG -3'
(R):5'- CACTTGACAGGTATAATGCTGCC -3'
Posted On2020-09-02