Incidental Mutation 'R8383:Tyr'
ID647026
Institutional Source Beutler Lab
Gene Symbol Tyr
Ensembl Gene ENSMUSG00000004651
Gene Nametyrosinase
SynonymsOca1, skc35
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_011661.4; MGI:98880

Is this an essential gene? Probably non essential (E-score: 0.207) question?
Stock #R8383 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location87424771-87493512 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87483992 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 289 (C289S)
Ref Sequence ENSEMBL: ENSMUSP00000004770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004770]
Predicted Effect probably damaging
Transcript: ENSMUST00000004770
AA Change: C289S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000004770
Gene: ENSMUSG00000004651
AA Change: C289S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
Pfam:Tyrosinase 170 403 4.8e-45 PFAM
transmembrane domain 474 496 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene catalyzes the first 2 steps, and at least 1 subsequent step, in the conversion of tyrosine to melanin. The enzyme has both tyrosine hydroxylase and dopa oxidase catalytic activities, and requires copper for function. Mutations in this gene result in oculocutaneous albinism, and nonpathologic polymorphisms result in skin pigmentation variation. The human genome contains a pseudogene similar to the 3' half of this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Numerous mutations at this locus result in albinism or hypopigmentation. Albinism is associated with reduced number of optic nerve fibers and mutants can have impaired vision. Some alleles are lethal. [provided by MGI curators]
Allele List at MGI

All alleles(120) : Targeted(2) Spontaneous(28) Chemically induced(16) Radiation induced(78

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A T 5: 121,607,373 M285K probably damaging Het
Adcyap1r1 T C 6: 55,480,000 S239P probably damaging Het
Alpk1 A T 3: 127,724,436 M72K probably benign Het
Alpk2 G T 18: 65,305,398 R975S probably benign Het
Ankrd7 A T 6: 18,868,411 K177N possibly damaging Het
Asxl1 A G 2: 153,393,719 T272A probably damaging Het
Ccdc175 A G 12: 72,109,178 Y666H possibly damaging Het
Cyp2j11 T C 4: 96,348,458 N37S probably benign Het
Dglucy A G 12: 100,835,329 D81G probably benign Het
Dysf T A 6: 84,019,583 D22E probably damaging Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm3415 C T 5: 146,558,418 P210L probably benign Het
Gm7995 A G 14: 42,311,364 H66R Het
Habp2 G A 19: 56,316,336 V388M probably damaging Het
Hey2 A G 10: 30,840,669 S33P probably benign Het
Hmbs C T 9: 44,337,943 R195H probably damaging Het
Hrnr A T 3: 93,332,346 Y3297F unknown Het
Hspg2 T A 4: 137,544,370 H2482Q possibly damaging Het
Ifi207 GAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG GGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,729,204 probably benign Het
Ifi208 T A 1: 173,683,509 V410E possibly damaging Het
Igkv3-7 A G 6: 70,607,750 T25A probably damaging Het
Il22ra1 A G 4: 135,734,140 Q72R probably damaging Het
Ip6k1 T A 9: 108,044,727 F207I possibly damaging Het
Kdm6b A G 11: 69,406,050 S464P probably benign Het
Kirrel3 G T 9: 35,029,883 M601I probably null Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Kmt2e A G 5: 23,485,541 N518S probably benign Het
Myo5b A G 18: 74,643,978 S370G probably benign Het
Nrn1l T C 8: 105,894,426 L50P probably damaging Het
Nrxn2 A G 19: 6,472,313 Y411C probably damaging Het
Obsl1 G T 1: 75,503,857 F374L possibly damaging Het
Olfr1093 A G 2: 86,786,530 I267V probably benign Het
Olfr344 A T 2: 36,569,002 I135F probably benign Het
Olfr352 A G 2: 36,870,331 Y255C probably damaging Het
Panx3 T A 9: 37,666,753 probably null Het
Piezo2 A T 18: 63,084,688 F1139L probably damaging Het
Pld2 G A 11: 70,551,429 D380N possibly damaging Het
Plekha7 A C 7: 116,144,919 N715K probably damaging Het
Pom121l12 T A 11: 14,599,353 S20T probably benign Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rdh8 G A 9: 20,822,785 probably null Het
Rgl3 G A 9: 21,977,233 T427I probably damaging Het
Rnf17 TG T 14: 56,424,542 probably null Het
Sclt1 A C 3: 41,742,015 I5S probably benign Het
Seh1l A G 18: 67,775,056 H16R possibly damaging Het
Sgca G A 11: 94,972,242 P95L probably benign Het
Spag17 T G 3: 100,085,392 S1735A probably damaging Het
Tdrd3 T C 14: 87,506,308 I564T probably benign Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 11: 94,214,377 probably benign Het
Trpv3 T G 11: 73,289,301 F524V probably benign Het
Ttc41 A G 10: 86,719,526 N282S probably benign Het
Txnrd2 T C 16: 18,472,864 L421P possibly damaging Het
Ubn1 A G 16: 5,077,358 E756G possibly damaging Het
Vps13a A T 19: 16,723,705 M700K possibly damaging Het
Zfhx2 A G 14: 55,074,071 S389P possibly damaging Het
Zfp667 T C 7: 6,305,371 L346P probably damaging Het
Zfp945 A G 17: 22,851,824 M388T probably benign Het
Zfp992 A G 4: 146,466,676 I285V probably benign Het
Other mutations in Tyr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Tyr APN 7 87437948 missense probably damaging 1.00
IGL01594:Tyr APN 7 87483814 splice site probably benign
IGL02963:Tyr APN 7 87483997 missense probably benign
IGL03356:Tyr APN 7 87492714 missense possibly damaging 0.71
ghost UTSW 7 87472495 missense probably damaging 1.00
pale_rider UTSW 7 87438023 missense probably damaging 1.00
rufus UTSW 7 87492706 missense probably damaging 1.00
siamese UTSW 7 87438044 missense probably damaging 0.99
Venusaur UTSW 7 87492706 missense probably damaging 1.00
waffle UTSW 7 87493221 missense possibly damaging 0.94
R0322:Tyr UTSW 7 87492917 missense probably benign 0.35
R0479:Tyr UTSW 7 87493221 missense possibly damaging 0.94
R1544:Tyr UTSW 7 87492706 missense probably damaging 1.00
R1546:Tyr UTSW 7 87437992 missense probably benign 0.02
R1606:Tyr UTSW 7 87437971 missense probably benign 0.01
R1666:Tyr UTSW 7 87492941 missense probably damaging 1.00
R2064:Tyr UTSW 7 87492843 missense probably benign 0.13
R2213:Tyr UTSW 7 87492878 missense probably damaging 1.00
R2420:Tyr UTSW 7 87429189 missense probably benign 0.17
R4013:Tyr UTSW 7 87437940 missense probably benign 0.00
R4014:Tyr UTSW 7 87437940 missense probably benign 0.00
R4015:Tyr UTSW 7 87437940 missense probably benign 0.00
R4016:Tyr UTSW 7 87437940 missense probably benign 0.00
R4202:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4205:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4206:Tyr UTSW 7 87429068 missense possibly damaging 0.92
R4361:Tyr UTSW 7 87429076 missense probably benign 0.01
R4738:Tyr UTSW 7 87492647 missense probably null 1.00
R5306:Tyr UTSW 7 87438014 missense probably damaging 1.00
R5378:Tyr UTSW 7 87472495 missense probably damaging 1.00
R5395:Tyr UTSW 7 87472490 missense probably damaging 0.98
R5782:Tyr UTSW 7 87493016 missense probably damaging 1.00
R7007:Tyr UTSW 7 87493340 missense probably benign 0.04
R7609:Tyr UTSW 7 87483884 missense probably benign 0.06
R7767:Tyr UTSW 7 87493010 missense probably benign 0.37
R7794:Tyr UTSW 7 87483820 critical splice donor site probably null
R8158:Tyr UTSW 7 87472516 missense probably damaging 0.99
R8403:Tyr UTSW 7 87437967 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAAGGATATTACCTTCCAGTG -3'
(R):5'- CACAAATTAGACTAGCGAGTGC -3'

Sequencing Primer
(F):5'- ACCTTCCAGTGTGTTTCTAAAGCTG -3'
(R):5'- ATTAGACTAGCGAGTGCCAGCC -3'
Posted On2020-09-02