Incidental Mutation 'R8383:Panx3'
ID647033
Institutional Source Beutler Lab
Gene Symbol Panx3
Ensembl Gene ENSMUSG00000011118
Gene Namepannexin 3
Synonyms4833413G11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8383 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location37659902-37669235 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 37666753 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000011262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011262] [ENSMUST00000011262] [ENSMUST00000142228]
Predicted Effect probably null
Transcript: ENSMUST00000011262
SMART Domains Protein: ENSMUSP00000011262
Gene: ENSMUSG00000011118

DomainStartEndE-ValueType
Pfam:Innexin 33 270 1.1e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000011262
SMART Domains Protein: ENSMUSP00000011262
Gene: ENSMUSG00000011118

DomainStartEndE-ValueType
Pfam:Innexin 33 270 1.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142228
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the innexin family. Innexin family members are known to be the structural components of gap junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit protection against surgically induced osteoarthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A T 5: 121,607,373 M285K probably damaging Het
Adcyap1r1 T C 6: 55,480,000 S239P probably damaging Het
Alpk1 A T 3: 127,724,436 M72K probably benign Het
Alpk2 G T 18: 65,305,398 R975S probably benign Het
Ankrd7 A T 6: 18,868,411 K177N possibly damaging Het
Asxl1 A G 2: 153,393,719 T272A probably damaging Het
Ccdc175 A G 12: 72,109,178 Y666H possibly damaging Het
Cyp2j11 T C 4: 96,348,458 N37S probably benign Het
Dglucy A G 12: 100,835,329 D81G probably benign Het
Dysf T A 6: 84,019,583 D22E probably damaging Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm3415 C T 5: 146,558,418 P210L probably benign Het
Gm7995 A G 14: 42,311,364 H66R Het
Habp2 G A 19: 56,316,336 V388M probably damaging Het
Hey2 A G 10: 30,840,669 S33P probably benign Het
Hmbs C T 9: 44,337,943 R195H probably damaging Het
Hrnr A T 3: 93,332,346 Y3297F unknown Het
Hspg2 T A 4: 137,544,370 H2482Q possibly damaging Het
Ifi207 GAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG GGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,729,204 probably benign Het
Ifi208 T A 1: 173,683,509 V410E possibly damaging Het
Igkv3-7 A G 6: 70,607,750 T25A probably damaging Het
Il22ra1 A G 4: 135,734,140 Q72R probably damaging Het
Ip6k1 T A 9: 108,044,727 F207I possibly damaging Het
Kdm6b A G 11: 69,406,050 S464P probably benign Het
Kirrel3 G T 9: 35,029,883 M601I probably null Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Kmt2e A G 5: 23,485,541 N518S probably benign Het
Myo5b A G 18: 74,643,978 S370G probably benign Het
Nrn1l T C 8: 105,894,426 L50P probably damaging Het
Nrxn2 A G 19: 6,472,313 Y411C probably damaging Het
Obsl1 G T 1: 75,503,857 F374L possibly damaging Het
Olfr1093 A G 2: 86,786,530 I267V probably benign Het
Olfr344 A T 2: 36,569,002 I135F probably benign Het
Olfr352 A G 2: 36,870,331 Y255C probably damaging Het
Piezo2 A T 18: 63,084,688 F1139L probably damaging Het
Pld2 G A 11: 70,551,429 D380N possibly damaging Het
Plekha7 A C 7: 116,144,919 N715K probably damaging Het
Pom121l12 T A 11: 14,599,353 S20T probably benign Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rdh8 G A 9: 20,822,785 probably null Het
Rgl3 G A 9: 21,977,233 T427I probably damaging Het
Rnf17 TG T 14: 56,424,542 probably null Het
Sclt1 A C 3: 41,742,015 I5S probably benign Het
Seh1l A G 18: 67,775,056 H16R possibly damaging Het
Sgca G A 11: 94,972,242 P95L probably benign Het
Spag17 T G 3: 100,085,392 S1735A probably damaging Het
Tdrd3 T C 14: 87,506,308 I564T probably benign Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 11: 94,214,377 probably benign Het
Trpv3 T G 11: 73,289,301 F524V probably benign Het
Ttc41 A G 10: 86,719,526 N282S probably benign Het
Txnrd2 T C 16: 18,472,864 L421P possibly damaging Het
Tyr A T 7: 87,483,992 C289S probably damaging Het
Ubn1 A G 16: 5,077,358 E756G possibly damaging Het
Vps13a A T 19: 16,723,705 M700K possibly damaging Het
Zfhx2 A G 14: 55,074,071 S389P possibly damaging Het
Zfp667 T C 7: 6,305,371 L346P probably damaging Het
Zfp945 A G 17: 22,851,824 M388T probably benign Het
Zfp992 A G 4: 146,466,676 I285V probably benign Het
Other mutations in Panx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Panx3 APN 9 37661471 missense probably damaging 1.00
IGL01371:Panx3 APN 9 37661475 missense probably benign 0.03
IGL01458:Panx3 APN 9 37661147 missense probably damaging 0.99
IGL01637:Panx3 APN 9 37664056 missense probably damaging 0.98
R1693:Panx3 UTSW 9 37668907 missense possibly damaging 0.64
R1693:Panx3 UTSW 9 37668946 missense possibly damaging 0.88
R1708:Panx3 UTSW 9 37661391 missense probably benign 0.00
R1818:Panx3 UTSW 9 37664026 missense probably benign 0.04
R2142:Panx3 UTSW 9 37666673 missense probably damaging 1.00
R5386:Panx3 UTSW 9 37669024 missense probably damaging 0.99
R5981:Panx3 UTSW 9 37668881 missense possibly damaging 0.93
R6273:Panx3 UTSW 9 37667429 missense probably benign 0.01
R6429:Panx3 UTSW 9 37661165 missense probably damaging 1.00
R6768:Panx3 UTSW 9 37664026 missense probably benign 0.04
R7082:Panx3 UTSW 9 37666617 missense probably benign 0.25
R7165:Panx3 UTSW 9 37664085 missense probably damaging 1.00
R7173:Panx3 UTSW 9 37661300 missense probably damaging 0.99
R7494:Panx3 UTSW 9 37661312 missense probably damaging 1.00
R7629:Panx3 UTSW 9 37661444 missense possibly damaging 0.83
R7650:Panx3 UTSW 9 37661405 missense probably damaging 0.97
R8032:Panx3 UTSW 9 37661670 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGAAAGGACCTCTGACTG -3'
(R):5'- CAGTACATTGGTAGCACAAGC -3'

Sequencing Primer
(F):5'- GAAAGGACCTCTGACTGCTTTAC -3'
(R):5'- GTAGCACAAGCCAAACTGTGTGTC -3'
Posted On2020-09-02