Incidental Mutation 'R8383:Myo5b'
ID 647056
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Name myosin VB
Synonyms
MMRRC Submission 067749-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.734) question?
Stock # R8383 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 74575435-74905769 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74777049 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 370 (S370G)
Ref Sequence ENSEMBL: ENSMUSP00000073790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000074157
AA Change: S370G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: S370G

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121875
AA Change: S370G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: S370G

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A T 5: 121,745,436 (GRCm39) M285K probably damaging Het
Adcyap1r1 T C 6: 55,456,985 (GRCm39) S239P probably damaging Het
Alpk1 A T 3: 127,518,085 (GRCm39) M72K probably benign Het
Alpk2 G T 18: 65,438,469 (GRCm39) R975S probably benign Het
Ankrd7 A T 6: 18,868,410 (GRCm39) K177N possibly damaging Het
Asxl1 A G 2: 153,235,639 (GRCm39) T272A probably damaging Het
Ccdc175 A G 12: 72,155,952 (GRCm39) Y666H possibly damaging Het
Cyp2j11 T C 4: 96,236,695 (GRCm39) N37S probably benign Het
Dglucy A G 12: 100,801,588 (GRCm39) D81G probably benign Het
Dysf T A 6: 83,996,565 (GRCm39) D22E probably damaging Het
Glg1 T C 8: 111,896,194 (GRCm39) T177A possibly damaging Het
Gm3415 C T 5: 146,495,228 (GRCm39) P210L probably benign Het
Gm7995 A G 14: 42,133,321 (GRCm39) H66R Het
Habp2 G A 19: 56,304,768 (GRCm39) V388M probably damaging Het
Hey2 A G 10: 30,716,665 (GRCm39) S33P probably benign Het
Hmbs C T 9: 44,249,240 (GRCm39) R195H probably damaging Het
Hrnr A T 3: 93,239,653 (GRCm39) Y3297F unknown Het
Hspg2 T A 4: 137,271,681 (GRCm39) H2482Q possibly damaging Het
Ifi207 GAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG GGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,556,770 (GRCm39) probably benign Het
Ifi208 T A 1: 173,511,075 (GRCm39) V410E possibly damaging Het
Igkv3-7 A G 6: 70,584,734 (GRCm39) T25A probably damaging Het
Il22ra1 A G 4: 135,461,451 (GRCm39) Q72R probably damaging Het
Ip6k1 T A 9: 107,921,926 (GRCm39) F207I possibly damaging Het
Kdm6b A G 11: 69,296,876 (GRCm39) S464P probably benign Het
Kirrel3 G T 9: 34,941,179 (GRCm39) M601I probably null Het
Klk1b1 C T 7: 43,619,767 (GRCm39) R109C possibly damaging Het
Kmt2e A G 5: 23,690,539 (GRCm39) N518S probably benign Het
Nrn1l T C 8: 106,621,058 (GRCm39) L50P probably damaging Het
Nrxn2 A G 19: 6,522,343 (GRCm39) Y411C probably damaging Het
Obsl1 G T 1: 75,480,501 (GRCm39) F374L possibly damaging Het
Or1j15 A T 2: 36,459,014 (GRCm39) I135F probably benign Het
Or1j20 A G 2: 36,760,343 (GRCm39) Y255C probably damaging Het
Or5t5 A G 2: 86,616,874 (GRCm39) I267V probably benign Het
Panx3 T A 9: 37,578,049 (GRCm39) probably null Het
Piezo2 A T 18: 63,217,759 (GRCm39) F1139L probably damaging Het
Pld2 G A 11: 70,442,255 (GRCm39) D380N possibly damaging Het
Plekha7 A C 7: 115,744,154 (GRCm39) N715K probably damaging Het
Pom121l12 T A 11: 14,549,353 (GRCm39) S20T probably benign Het
Rasal1 C T 5: 120,804,420 (GRCm39) R431C probably benign Het
Rdh8 G A 9: 20,734,081 (GRCm39) probably null Het
Rgl3 G A 9: 21,888,529 (GRCm39) T427I probably damaging Het
Rnf17 TG T 14: 56,661,999 (GRCm39) 132 probably null Het
Sclt1 A C 3: 41,696,450 (GRCm39) I5S probably benign Het
Seh1l A G 18: 67,908,126 (GRCm39) H16R possibly damaging Het
Sgca G A 11: 94,863,068 (GRCm39) P95L probably benign Het
Spag17 T G 3: 99,992,708 (GRCm39) S1735A probably damaging Het
Tdrd3 T C 14: 87,743,744 (GRCm39) I564T probably benign Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 11: 94,105,203 (GRCm39) probably benign Het
Trpv3 T G 11: 73,180,127 (GRCm39) F524V probably benign Het
Ttc41 A G 10: 86,555,390 (GRCm39) N282S probably benign Het
Txnrd2 T C 16: 18,291,614 (GRCm39) L421P possibly damaging Het
Tyr A T 7: 87,133,200 (GRCm39) C289S probably damaging Het
Ubn1 A G 16: 4,895,222 (GRCm39) E756G possibly damaging Het
Vps13a A T 19: 16,701,069 (GRCm39) M700K possibly damaging Het
Zfhx2 A G 14: 55,311,528 (GRCm39) S389P possibly damaging Het
Zfp667 T C 7: 6,308,370 (GRCm39) L346P probably damaging Het
Zfp945 A G 17: 23,070,798 (GRCm39) M388T probably benign Het
Zfp992 A G 4: 146,551,133 (GRCm39) I285V probably benign Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74,787,147 (GRCm39) splice site probably benign
IGL01083:Myo5b APN 18 74,866,974 (GRCm39) splice site probably benign
IGL01448:Myo5b APN 18 74,777,161 (GRCm39) missense probably damaging 0.97
IGL01516:Myo5b APN 18 74,760,266 (GRCm39) missense probably damaging 0.99
IGL01525:Myo5b APN 18 74,873,620 (GRCm39) missense probably damaging 1.00
IGL01873:Myo5b APN 18 74,713,467 (GRCm39) missense probably damaging 1.00
IGL01887:Myo5b APN 18 74,848,007 (GRCm39) missense probably benign 0.41
IGL01953:Myo5b APN 18 74,702,838 (GRCm39) missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74,831,348 (GRCm39) missense probably damaging 1.00
IGL02017:Myo5b APN 18 74,850,070 (GRCm39) missense probably damaging 1.00
IGL02331:Myo5b APN 18 74,771,111 (GRCm39) critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74,848,010 (GRCm39) missense probably damaging 0.98
IGL02707:Myo5b APN 18 74,828,438 (GRCm39) splice site probably benign
IGL02806:Myo5b APN 18 74,750,151 (GRCm39) critical splice donor site probably null
IGL03009:Myo5b APN 18 74,894,039 (GRCm39) missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74,713,615 (GRCm39) splice site probably benign
IGL03061:Myo5b APN 18 74,767,630 (GRCm39) missense probably benign 0.02
unrat UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
BB007:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
BB017:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R0085:Myo5b UTSW 18 74,834,751 (GRCm39) missense probably benign 0.21
R0114:Myo5b UTSW 18 74,875,242 (GRCm39) missense probably benign 0.03
R0226:Myo5b UTSW 18 74,875,251 (GRCm39) missense probably benign
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74,794,787 (GRCm39) missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74,862,025 (GRCm39) splice site probably benign
R0494:Myo5b UTSW 18 74,787,038 (GRCm39) missense probably damaging 1.00
R0920:Myo5b UTSW 18 74,758,712 (GRCm39) missense probably benign 0.09
R1144:Myo5b UTSW 18 74,758,658 (GRCm39) missense probably damaging 1.00
R1177:Myo5b UTSW 18 74,777,143 (GRCm39) missense probably damaging 1.00
R1387:Myo5b UTSW 18 74,777,272 (GRCm39) splice site probably benign
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1468:Myo5b UTSW 18 74,873,574 (GRCm39) missense probably damaging 0.99
R1555:Myo5b UTSW 18 74,702,853 (GRCm39) missense probably damaging 1.00
R1587:Myo5b UTSW 18 74,867,061 (GRCm39) missense probably benign
R1600:Myo5b UTSW 18 74,846,611 (GRCm39) unclassified probably benign
R1639:Myo5b UTSW 18 74,840,987 (GRCm39) missense probably benign 0.19
R1779:Myo5b UTSW 18 74,875,218 (GRCm39) missense probably benign 0.06
R1806:Myo5b UTSW 18 74,710,680 (GRCm39) missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2046:Myo5b UTSW 18 74,710,526 (GRCm39) missense probably benign 0.28
R2093:Myo5b UTSW 18 74,892,263 (GRCm39) missense probably damaging 0.98
R2270:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2272:Myo5b UTSW 18 74,866,996 (GRCm39) missense probably damaging 0.99
R2298:Myo5b UTSW 18 74,758,676 (GRCm39) missense probably damaging 1.00
R2433:Myo5b UTSW 18 74,892,158 (GRCm39) missense probably damaging 1.00
R2888:Myo5b UTSW 18 74,895,689 (GRCm39) missense probably damaging 1.00
R3824:Myo5b UTSW 18 74,794,726 (GRCm39) missense probably benign 0.41
R3937:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3938:Myo5b UTSW 18 74,849,108 (GRCm39) missense probably damaging 0.98
R3947:Myo5b UTSW 18 74,828,474 (GRCm39) missense probably damaging 1.00
R3971:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3972:Myo5b UTSW 18 74,873,598 (GRCm39) missense probably damaging 1.00
R3974:Myo5b UTSW 18 74,767,552 (GRCm39) missense probably damaging 1.00
R4027:Myo5b UTSW 18 74,892,311 (GRCm39) missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74,873,559 (GRCm39) missense probably benign
R4285:Myo5b UTSW 18 74,847,920 (GRCm39) missense probably benign
R4308:Myo5b UTSW 18 74,864,811 (GRCm39) missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74,831,345 (GRCm39) missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74,713,479 (GRCm39) missense probably damaging 1.00
R4516:Myo5b UTSW 18 74,758,745 (GRCm39) missense probably damaging 1.00
R4690:Myo5b UTSW 18 74,855,533 (GRCm39) missense probably damaging 0.97
R4781:Myo5b UTSW 18 74,877,752 (GRCm39) missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74,828,451 (GRCm39) missense probably benign 0.01
R4796:Myo5b UTSW 18 74,877,701 (GRCm39) missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74,828,455 (GRCm39) missense probably benign 0.19
R4972:Myo5b UTSW 18 74,760,264 (GRCm39) missense probably damaging 0.98
R5004:Myo5b UTSW 18 74,877,844 (GRCm39) critical splice donor site probably null
R5024:Myo5b UTSW 18 74,849,105 (GRCm39) missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74,771,224 (GRCm39) critical splice donor site probably null
R5187:Myo5b UTSW 18 74,834,745 (GRCm39) missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74,848,003 (GRCm39) missense probably damaging 0.99
R5254:Myo5b UTSW 18 74,833,677 (GRCm39) missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74,795,741 (GRCm39) missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74,875,246 (GRCm39) missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74,787,128 (GRCm39) missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74,834,592 (GRCm39) missense probably benign
R5875:Myo5b UTSW 18 74,840,973 (GRCm39) splice site probably null
R6088:Myo5b UTSW 18 74,853,969 (GRCm39) missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74,833,750 (GRCm39) missense probably benign 0.19
R6237:Myo5b UTSW 18 74,875,249 (GRCm39) missense probably damaging 1.00
R6265:Myo5b UTSW 18 74,710,511 (GRCm39) splice site probably null
R6267:Myo5b UTSW 18 74,750,062 (GRCm39) missense probably damaging 1.00
R6328:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6330:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6331:Myo5b UTSW 18 74,750,064 (GRCm39) missense probably damaging 1.00
R6347:Myo5b UTSW 18 74,903,456 (GRCm39) missense probably benign 0.11
R6479:Myo5b UTSW 18 74,750,086 (GRCm39) missense probably damaging 1.00
R6748:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74,834,574 (GRCm39) missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74,750,106 (GRCm39) missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74,903,396 (GRCm39) missense probably benign
R6876:Myo5b UTSW 18 74,841,026 (GRCm39) missense probably benign
R6880:Myo5b UTSW 18 74,855,501 (GRCm39) missense probably benign 0.02
R6902:Myo5b UTSW 18 74,809,756 (GRCm39) missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74,786,432 (GRCm39) missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74,834,599 (GRCm39) missense probably benign 0.01
R7162:Myo5b UTSW 18 74,828,498 (GRCm39) missense probably benign 0.02
R7345:Myo5b UTSW 18 74,841,095 (GRCm39) missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74,864,802 (GRCm39) missense probably benign 0.00
R7564:Myo5b UTSW 18 74,767,582 (GRCm39) missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74,760,325 (GRCm39) critical splice donor site probably null
R7635:Myo5b UTSW 18 74,713,467 (GRCm39) missense probably damaging 1.00
R7670:Myo5b UTSW 18 74,834,517 (GRCm39) missense probably benign 0.05
R7754:Myo5b UTSW 18 74,767,630 (GRCm39) missense probably benign 0.02
R7930:Myo5b UTSW 18 74,864,825 (GRCm39) missense probably benign
R8013:Myo5b UTSW 18 74,893,970 (GRCm39) nonsense probably null
R8271:Myo5b UTSW 18 74,760,261 (GRCm39) missense probably damaging 1.00
R8312:Myo5b UTSW 18 74,867,033 (GRCm39) missense probably damaging 1.00
R8384:Myo5b UTSW 18 74,875,273 (GRCm39) missense probably damaging 1.00
R8474:Myo5b UTSW 18 74,903,411 (GRCm39) missense probably damaging 1.00
R8825:Myo5b UTSW 18 74,892,169 (GRCm39) missense possibly damaging 0.79
R8846:Myo5b UTSW 18 74,841,043 (GRCm39) missense probably benign 0.04
R9236:Myo5b UTSW 18 74,853,934 (GRCm39) missense probably benign
R9283:Myo5b UTSW 18 74,777,149 (GRCm39) missense probably benign 0.16
R9370:Myo5b UTSW 18 74,760,246 (GRCm39) missense possibly damaging 0.54
R9506:Myo5b UTSW 18 74,877,831 (GRCm39) missense possibly damaging 0.82
R9523:Myo5b UTSW 18 74,861,968 (GRCm39) missense possibly damaging 0.89
R9622:Myo5b UTSW 18 74,848,017 (GRCm39) missense probably damaging 0.99
R9676:Myo5b UTSW 18 74,892,231 (GRCm39) missense probably benign 0.22
R9725:Myo5b UTSW 18 74,856,841 (GRCm39) missense probably benign
RF009:Myo5b UTSW 18 74,777,070 (GRCm39) missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74,877,820 (GRCm39) missense probably benign 0.35
Z1177:Myo5b UTSW 18 74,750,088 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGTGCACAGGAGCCTATCTC -3'
(R):5'- TATCCAGGACCCCGATGAAG -3'

Sequencing Primer
(F):5'- AATGCCCTACAGTTGGATCTCATGG -3'
(R):5'- ACCCCGATGAAGGAGTGCTG -3'
Posted On 2020-09-02