Incidental Mutation 'R8383:Myo5b'
ID647056
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Namemyosin VB
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.779) question?
Stock #R8383 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location74440936-74771493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74643978 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 370 (S370G)
Ref Sequence ENSEMBL: ENSMUSP00000073790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
Predicted Effect probably benign
Transcript: ENSMUST00000074157
AA Change: S370G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: S370G

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121875
AA Change: S370G

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: S370G

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad12 A T 5: 121,607,373 M285K probably damaging Het
Adcyap1r1 T C 6: 55,480,000 S239P probably damaging Het
Alpk1 A T 3: 127,724,436 M72K probably benign Het
Alpk2 G T 18: 65,305,398 R975S probably benign Het
Ankrd7 A T 6: 18,868,411 K177N possibly damaging Het
Asxl1 A G 2: 153,393,719 T272A probably damaging Het
Ccdc175 A G 12: 72,109,178 Y666H possibly damaging Het
Cyp2j11 T C 4: 96,348,458 N37S probably benign Het
Dglucy A G 12: 100,835,329 D81G probably benign Het
Dysf T A 6: 84,019,583 D22E probably damaging Het
Glg1 T C 8: 111,169,562 T177A possibly damaging Het
Gm3415 C T 5: 146,558,418 P210L probably benign Het
Gm7995 A G 14: 42,311,364 H66R Het
Habp2 G A 19: 56,316,336 V388M probably damaging Het
Hey2 A G 10: 30,840,669 S33P probably benign Het
Hmbs C T 9: 44,337,943 R195H probably damaging Het
Hrnr A T 3: 93,332,346 Y3297F unknown Het
Hspg2 T A 4: 137,544,370 H2482Q possibly damaging Het
Ifi207 GAAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG GGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGTTGTTGATAGAGTTGCATGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATACAGTTGCTTGTGGAGCCAGGAGGTTGCTAGATGCTGTTGATAGAGTTGCATATGGAGCCAGGAGGATGCTATATGTTGTTGATGAAGTTGCATGTGGAGCCAGGAG 1: 173,729,204 probably benign Het
Ifi208 T A 1: 173,683,509 V410E possibly damaging Het
Igkv3-7 A G 6: 70,607,750 T25A probably damaging Het
Il22ra1 A G 4: 135,734,140 Q72R probably damaging Het
Ip6k1 T A 9: 108,044,727 F207I possibly damaging Het
Kdm6b A G 11: 69,406,050 S464P probably benign Het
Kirrel3 G T 9: 35,029,883 M601I probably null Het
Klk1b1 C T 7: 43,970,343 R109C possibly damaging Het
Kmt2e A G 5: 23,485,541 N518S probably benign Het
Nrn1l T C 8: 105,894,426 L50P probably damaging Het
Nrxn2 A G 19: 6,472,313 Y411C probably damaging Het
Obsl1 G T 1: 75,503,857 F374L possibly damaging Het
Olfr1093 A G 2: 86,786,530 I267V probably benign Het
Olfr344 A T 2: 36,569,002 I135F probably benign Het
Olfr352 A G 2: 36,870,331 Y255C probably damaging Het
Panx3 T A 9: 37,666,753 probably null Het
Piezo2 A T 18: 63,084,688 F1139L probably damaging Het
Pld2 G A 11: 70,551,429 D380N possibly damaging Het
Plekha7 A C 7: 116,144,919 N715K probably damaging Het
Pom121l12 T A 11: 14,599,353 S20T probably benign Het
Rasal1 C T 5: 120,666,355 R431C probably benign Het
Rdh8 G A 9: 20,822,785 probably null Het
Rgl3 G A 9: 21,977,233 T427I probably damaging Het
Rnf17 TG T 14: 56,424,542 probably null Het
Sclt1 A C 3: 41,742,015 I5S probably benign Het
Seh1l A G 18: 67,775,056 H16R possibly damaging Het
Sgca G A 11: 94,972,242 P95L probably benign Het
Spag17 T G 3: 100,085,392 S1735A probably damaging Het
Tdrd3 T C 14: 87,506,308 I564T probably benign Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGC 11: 94,214,377 probably benign Het
Trpv3 T G 11: 73,289,301 F524V probably benign Het
Ttc41 A G 10: 86,719,526 N282S probably benign Het
Txnrd2 T C 16: 18,472,864 L421P possibly damaging Het
Tyr A T 7: 87,483,992 C289S probably damaging Het
Ubn1 A G 16: 5,077,358 E756G possibly damaging Het
Vps13a A T 19: 16,723,705 M700K possibly damaging Het
Zfhx2 A G 14: 55,074,071 S389P possibly damaging Het
Zfp667 T C 7: 6,305,371 L346P probably damaging Het
Zfp945 A G 17: 22,851,824 M388T probably benign Het
Zfp992 A G 4: 146,466,676 I285V probably benign Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74654076 splice site probably benign
IGL01083:Myo5b APN 18 74733903 splice site probably benign
IGL01448:Myo5b APN 18 74644090 missense probably damaging 0.97
IGL01516:Myo5b APN 18 74627195 missense probably damaging 0.99
IGL01525:Myo5b APN 18 74740549 missense probably damaging 1.00
IGL01873:Myo5b APN 18 74580396 missense probably damaging 1.00
IGL01887:Myo5b APN 18 74714936 missense probably benign 0.41
IGL01953:Myo5b APN 18 74569767 missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74698277 missense probably damaging 1.00
IGL02017:Myo5b APN 18 74716999 missense probably damaging 1.00
IGL02331:Myo5b APN 18 74638040 critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74714939 missense probably damaging 0.98
IGL02707:Myo5b APN 18 74695367 splice site probably benign
IGL02806:Myo5b APN 18 74617080 critical splice donor site probably null
IGL03009:Myo5b APN 18 74760968 missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74634559 missense probably benign 0.02
IGL03061:Myo5b APN 18 74580544 splice site probably benign
unrat UTSW 18 74653361 missense possibly damaging 0.93
BB007:Myo5b UTSW 18 74731754 missense probably benign
BB017:Myo5b UTSW 18 74731754 missense probably benign
R0085:Myo5b UTSW 18 74701680 missense probably benign 0.21
R0114:Myo5b UTSW 18 74742171 missense probably benign 0.03
R0226:Myo5b UTSW 18 74742180 missense probably benign
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74728954 splice site probably benign
R0494:Myo5b UTSW 18 74653967 missense probably damaging 1.00
R0920:Myo5b UTSW 18 74625641 missense probably benign 0.09
R1144:Myo5b UTSW 18 74625587 missense probably damaging 1.00
R1177:Myo5b UTSW 18 74644072 missense probably damaging 1.00
R1387:Myo5b UTSW 18 74644201 splice site probably benign
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1555:Myo5b UTSW 18 74569782 missense probably damaging 1.00
R1587:Myo5b UTSW 18 74733990 missense probably benign
R1600:Myo5b UTSW 18 74713540 unclassified probably benign
R1639:Myo5b UTSW 18 74707916 missense probably benign 0.19
R1779:Myo5b UTSW 18 74742147 missense probably benign 0.06
R1806:Myo5b UTSW 18 74577609 missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2046:Myo5b UTSW 18 74577455 missense probably benign 0.28
R2093:Myo5b UTSW 18 74759192 missense probably damaging 0.98
R2270:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2272:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2298:Myo5b UTSW 18 74625605 missense probably damaging 1.00
R2433:Myo5b UTSW 18 74759087 missense probably damaging 1.00
R2888:Myo5b UTSW 18 74762618 missense probably damaging 1.00
R3824:Myo5b UTSW 18 74661655 missense probably benign 0.41
R3937:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3938:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3947:Myo5b UTSW 18 74695403 missense probably damaging 1.00
R3971:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3972:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3974:Myo5b UTSW 18 74634481 missense probably damaging 1.00
R4027:Myo5b UTSW 18 74759240 missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74740488 missense probably benign
R4285:Myo5b UTSW 18 74714849 missense probably benign
R4308:Myo5b UTSW 18 74731740 missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74698274 missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74580408 missense probably damaging 1.00
R4516:Myo5b UTSW 18 74625674 missense probably damaging 1.00
R4690:Myo5b UTSW 18 74722462 missense probably damaging 0.97
R4781:Myo5b UTSW 18 74744681 missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74695380 missense probably benign 0.01
R4796:Myo5b UTSW 18 74744630 missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74695384 missense probably benign 0.19
R4972:Myo5b UTSW 18 74627193 missense probably damaging 0.98
R5004:Myo5b UTSW 18 74744773 critical splice donor site probably null
R5024:Myo5b UTSW 18 74716034 missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74638153 critical splice donor site probably null
R5187:Myo5b UTSW 18 74701674 missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74714932 missense probably damaging 0.99
R5254:Myo5b UTSW 18 74700606 missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74662670 missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74742175 missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74654057 missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74701521 missense probably benign
R5875:Myo5b UTSW 18 74707902 splice site probably null
R6088:Myo5b UTSW 18 74720898 missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74700679 missense probably benign 0.19
R6237:Myo5b UTSW 18 74742178 missense probably damaging 1.00
R6265:Myo5b UTSW 18 74577440 splice site probably null
R6267:Myo5b UTSW 18 74616991 missense probably damaging 1.00
R6328:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6330:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6331:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6347:Myo5b UTSW 18 74770385 missense probably benign 0.11
R6479:Myo5b UTSW 18 74617015 missense probably damaging 1.00
R6748:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74617035 missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74770325 missense probably benign
R6876:Myo5b UTSW 18 74707955 missense probably benign
R6880:Myo5b UTSW 18 74722430 missense probably benign 0.02
R6902:Myo5b UTSW 18 74676685 missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74653361 missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74701528 missense probably benign 0.01
R7162:Myo5b UTSW 18 74695427 missense probably benign 0.02
R7345:Myo5b UTSW 18 74708024 missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74731731 missense probably benign 0.00
R7564:Myo5b UTSW 18 74634511 missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74627254 critical splice donor site probably null
R7635:Myo5b UTSW 18 74580396 missense probably damaging 1.00
R7670:Myo5b UTSW 18 74701446 missense probably benign 0.05
R7754:Myo5b UTSW 18 74634559 missense probably benign 0.02
R7930:Myo5b UTSW 18 74731754 missense probably benign
R8013:Myo5b UTSW 18 74760899 nonsense probably null
R8271:Myo5b UTSW 18 74627190 missense probably damaging 1.00
R8312:Myo5b UTSW 18 74733962 missense probably damaging 1.00
R8384:Myo5b UTSW 18 74742202 missense probably damaging 1.00
RF009:Myo5b UTSW 18 74643999 missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74744749 missense probably benign 0.35
Z1177:Myo5b UTSW 18 74617017 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGTGCACAGGAGCCTATCTC -3'
(R):5'- TATCCAGGACCCCGATGAAG -3'

Sequencing Primer
(F):5'- AATGCCCTACAGTTGGATCTCATGG -3'
(R):5'- ACCCCGATGAAGGAGTGCTG -3'
Posted On2020-09-02