Incidental Mutation 'R0041:Olfml1'
ID64706
Institutional Source Beutler Lab
Gene Symbol Olfml1
Ensembl Gene ENSMUSG00000051041
Gene Nameolfactomedin-like 1
SynonymsONT2, mONT2, MVAL564
MMRRC Submission 038335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0041 (G1)
Quality Score127
Status Validated
Chromosome7
Chromosomal Location107567446-107591094 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107590186 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 153 (I153L)
Ref Sequence ENSEMBL: ENSMUSP00000114029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120990]
Predicted Effect possibly damaging
Transcript: ENSMUST00000120990
AA Change: I153L

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114029
Gene: ENSMUSG00000051041
AA Change: I153L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
coiled coil region 78 105 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
Pfam:OLF 145 233 5.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207374
Meta Mutation Damage Score 0.0910 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Avpi1 C A 19: 42,123,784 E112* probably null Het
Braf C T 6: 39,640,479 A534T probably damaging Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cdhr2 A T 13: 54,726,838 S908C probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Efna5 A T 17: 62,607,472 probably benign Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Galnt4 A G 10: 99,108,512 Y33C probably benign Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Krt71 C A 15: 101,739,318 E222D probably damaging Het
Ltf T A 9: 111,029,568 D461E possibly damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Olfr954 T A 9: 39,461,476 F12Y probably benign Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Peg12 T A 7: 62,463,560 E263V unknown Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rlf T A 4: 121,149,929 H618L probably damaging Het
Rnf112 T A 11: 61,452,355 R165W probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rnf220 A G 4: 117,273,284 L293P probably damaging Het
Rock1 T C 18: 10,140,240 D117G probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Rpl7a A G 2: 26,911,551 probably null Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Swap70 A G 7: 110,279,355 K511E probably benign Het
Treh T C 9: 44,683,613 V262A probably benign Het
Trpm4 A G 7: 45,304,946 probably null Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Wdr64 G A 1: 175,726,471 W189* probably null Het
Other mutations in Olfml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Olfml1 APN 7 107590157 missense possibly damaging 0.80
IGL02355:Olfml1 APN 7 107567803 missense probably benign 0.00
IGL02362:Olfml1 APN 7 107567803 missense probably benign 0.00
IGL03218:Olfml1 APN 7 107571269 missense possibly damaging 0.87
IGL03291:Olfml1 APN 7 107590229 missense probably damaging 1.00
R0041:Olfml1 UTSW 7 107590186 missense possibly damaging 0.81
R0081:Olfml1 UTSW 7 107571299 missense probably benign 0.08
R0524:Olfml1 UTSW 7 107590177 missense probably damaging 1.00
R1311:Olfml1 UTSW 7 107567896 critical splice donor site probably null
R1548:Olfml1 UTSW 7 107590375 missense possibly damaging 0.88
R1564:Olfml1 UTSW 7 107571139 missense possibly damaging 0.89
R4347:Olfml1 UTSW 7 107567833 missense probably benign 0.00
R4997:Olfml1 UTSW 7 107571206 missense probably damaging 1.00
R6788:Olfml1 UTSW 7 107567868 missense probably damaging 1.00
R7282:Olfml1 UTSW 7 107590323 missense possibly damaging 0.85
R7703:Olfml1 UTSW 7 107571185 missense probably damaging 1.00
R7922:Olfml1 UTSW 7 107571149 missense probably damaging 1.00
R8324:Olfml1 UTSW 7 107590363 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCATACAAGTTAAGACCAGGCAGC -3'
(R):5'- TTGGTAGACCACTTGCCCTGATCC -3'

Sequencing Primer
(F):5'- CTTCTACTACAGGTAAGGGTCAG -3'
(R):5'- TGATCCCTGCCAGGAAAGTG -3'
Posted On2013-08-06