Incidental Mutation 'R8384:Serpinb3c'
ID 647061
Institutional Source Beutler Lab
Gene Symbol Serpinb3c
Ensembl Gene ENSMUSG00000073601
Gene Name serine (or cysteine) peptidase inhibitor, clade B, member 3C
Synonyms 1110001H02Rik, Scca2, Serpinb4, ovalbumin, 1110013A16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock # R8384 (G1)
Quality Score 215.009
Status Not validated
Chromosome 1
Chromosomal Location 107271201-107278371 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107271967 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 275 (T275A)
Ref Sequence ENSEMBL: ENSMUSP00000027565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027565] [ENSMUST00000166100]
AlphaFold A2RSF9
Predicted Effect probably benign
Transcript: ENSMUST00000027565
AA Change: T275A

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000027565
Gene: ENSMUSG00000073601
AA Change: T275A

DomainStartEndE-ValueType
SERPIN 13 386 7.91e-169 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166100
SMART Domains Protein: ENSMUSP00000132370
Gene: ENSMUSG00000073602

DomainStartEndE-ValueType
SERPIN 13 387 4.75e-181 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,166,765 D736G probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Col6a6 C T 9: 105,755,694 G1457D probably damaging Het
Colec11 A T 12: 28,594,659 *279R probably null Het
Ctnnbl1 A T 2: 157,818,060 E278V probably benign Het
Cyp24a1 A G 2: 170,486,769 probably null Het
D1Ertd622e A G 1: 97,645,930 C137R possibly damaging Het
Dpp6 A T 5: 27,718,474 Y694F probably benign Het
Eif5 A G 12: 111,539,805 E26G possibly damaging Het
Fhdc1 T C 3: 84,454,999 I305V possibly damaging Het
Flvcr2 T C 12: 85,796,193 F347S possibly damaging Het
Gm9803 A T 10: 43,524,351 I34F probably damaging Het
Hacl1 A G 14: 31,634,197 probably null Het
Hells A G 19: 38,959,122 T667A probably benign Het
Idua A G 5: 108,681,439 T416A possibly damaging Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Lnx2 G A 5: 147,029,328 A327V probably benign Het
Mdn1 T C 4: 32,765,680 V5220A probably benign Het
Mpst T A 15: 78,413,575 C264* probably null Het
Msh5 A G 17: 35,030,637 L644P probably damaging Het
Myo5b A G 18: 74,742,202 Y1533C probably damaging Het
Naa38 A G 11: 69,395,926 E12G probably benign Het
Obscn C A 11: 59,085,109 C2064F probably damaging Het
Olfr470 A T 7: 107,845,258 N158K possibly damaging Het
Olfr782 A T 10: 129,350,826 K88* probably null Het
Ralgds G T 2: 28,547,170 A534S probably damaging Het
Rgs22 A T 15: 36,046,012 probably null Het
Slc7a13 T C 4: 19,823,984 V251A probably damaging Het
Snx14 C A 9: 88,403,280 E444* probably null Het
Sspo G T 6: 48,482,664 W3319L probably damaging Het
Ugt2b5 A G 5: 87,140,065 V81A probably benign Het
Usp6nl A G 2: 6,427,793 I326V possibly damaging Het
Zcchc17 T C 4: 130,316,733 K214E possibly damaging Het
Zfp638 C A 6: 83,979,765 H1785N probably benign Het
Other mutations in Serpinb3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00847:Serpinb3c APN 1 107276260 critical splice donor site probably null
IGL01349:Serpinb3c APN 1 107272783 missense probably damaging 1.00
IGL01730:Serpinb3c APN 1 107273184 missense probably damaging 0.99
IGL01732:Serpinb3c APN 1 107271972 missense probably benign
IGL02184:Serpinb3c APN 1 107271918 missense probably damaging 0.96
IGL02742:Serpinb3c APN 1 107273142 nonsense probably null
IGL03131:Serpinb3c APN 1 107271727 missense probably benign 0.09
IGL03394:Serpinb3c APN 1 107271873 missense probably benign 0.00
BB001:Serpinb3c UTSW 1 107273174 missense probably damaging 1.00
BB011:Serpinb3c UTSW 1 107273174 missense probably damaging 1.00
R0207:Serpinb3c UTSW 1 107276992 missense probably benign 0.02
R0508:Serpinb3c UTSW 1 107276921 missense probably damaging 1.00
R1542:Serpinb3c UTSW 1 107272787 missense probably damaging 1.00
R1660:Serpinb3c UTSW 1 107271702 missense probably damaging 1.00
R1731:Serpinb3c UTSW 1 107271774 missense probably damaging 0.99
R2012:Serpinb3c UTSW 1 107271844 missense possibly damaging 0.92
R5361:Serpinb3c UTSW 1 107276931 nonsense probably null
R5464:Serpinb3c UTSW 1 107271704 missense probably damaging 0.99
R5636:Serpinb3c UTSW 1 107275014 missense possibly damaging 0.57
R5677:Serpinb3c UTSW 1 107271803 missense probably damaging 1.00
R5965:Serpinb3c UTSW 1 107276923 missense probably benign 0.01
R6424:Serpinb3c UTSW 1 107271629 makesense probably null
R7132:Serpinb3c UTSW 1 107276951 missense probably damaging 0.96
R7161:Serpinb3c UTSW 1 107273162 missense probably null 1.00
R7319:Serpinb3c UTSW 1 107273087 missense possibly damaging 0.92
R7437:Serpinb3c UTSW 1 107271714 missense probably damaging 1.00
R7871:Serpinb3c UTSW 1 107273153 missense possibly damaging 0.95
R7922:Serpinb3c UTSW 1 107272014 missense probably damaging 1.00
R7924:Serpinb3c UTSW 1 107273174 missense probably damaging 1.00
R8114:Serpinb3c UTSW 1 107276304 missense probably benign 0.03
R8189:Serpinb3c UTSW 1 107276309 missense probably benign 0.00
R9042:Serpinb3c UTSW 1 107272001 missense probably damaging 1.00
R9518:Serpinb3c UTSW 1 107272738 missense probably damaging 0.99
R9566:Serpinb3c UTSW 1 107272695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAGGATCAGCTTCTGTTC -3'
(R):5'- TGATGCCACTCATATAGAACAACTC -3'

Sequencing Primer
(F):5'- TCATTTACCTCCACAAAGGACTTG -3'
(R):5'- GAACAACTCAAACTTGGTTGAAAG -3'
Posted On 2020-09-02