Mutagenetix > Incidental Mutations

Incidental Mutation 'R8384:Ugt2b5'

647071

Institutional Source

Beutler Lab

Gene Symbol

Ugt2b5

Ensembl Gene

ENSMUSG00000054630

Gene Name

UDP glucuronosyltransferase 2 family, polypeptide B5

Synonyms

Udpgt-3, m-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R8384 (G1)

Quality Score

151.008

Status

Not validated

Chromosome

Chromosomal Location

87124960-87140318 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87140065 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 81 (V81A)

Ref Sequence

ENSEMBL: ENSMUSP00000068282 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067790]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000067790
AA Change: V81A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000068282
Gene: ENSMUSG00000054630
AA Change: V81A

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:UDPGT	24	527	7.9e-256	PFAM
Pfam:Glyco_tran_28_C	352	449	5.3e-8	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	T	C	11: 72,166,765	D736G	probably benign	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Col6a6	C	T	9: 105,755,694	G1457D	probably damaging	Het
Colec11	A	T	12: 28,594,659	*279R	probably null	Het
Ctnnbl1	A	T	2: 157,818,060	E278V	probably benign	Het
Cyp24a1	A	G	2: 170,486,769		probably null	Het
D1Ertd622e	A	G	1: 97,645,930	C137R	possibly damaging	Het
Dpp6	A	T	5: 27,718,474	Y694F	probably benign	Het
Eif5	A	G	12: 111,539,805	E26G	possibly damaging	Het
Fhdc1	T	C	3: 84,454,999	I305V	possibly damaging	Het
Flvcr2	T	C	12: 85,796,193	F347S	possibly damaging	Het
Gm9803	A	T	10: 43,524,351	I34F	probably damaging	Het
Hacl1	A	G	14: 31,634,197		probably null	Het
Hells	A	G	19: 38,959,122	T667A	probably benign	Het
Idua	A	G	5: 108,681,439	T416A	possibly damaging	Het
Lfng	G	A	5: 140,613,226	E297K	probably damaging	Het
Lnx2	G	A	5: 147,029,328	A327V	probably benign	Het
Mdn1	T	C	4: 32,765,680	V5220A	probably benign	Het
Mpst	T	A	15: 78,413,575	C264*	probably null	Het
Msh5	A	G	17: 35,030,637	L644P	probably damaging	Het
Myo5b	A	G	18: 74,742,202	Y1533C	probably damaging	Het
Naa38	A	G	11: 69,395,926	E12G	probably benign	Het
Obscn	C	A	11: 59,085,109	C2064F	probably damaging	Het
Olfr470	A	T	7: 107,845,258	N158K	possibly damaging	Het
Olfr782	A	T	10: 129,350,826	K88*	probably null	Het
Ralgds	G	T	2: 28,547,170	A534S	probably damaging	Het
Rgs22	A	T	15: 36,046,012		probably null	Het
Serpinb3c	T	C	1: 107,271,967	T275A	probably benign	Het
Slc7a13	T	C	4: 19,823,984	V251A	probably damaging	Het
Snx14	C	A	9: 88,403,280	E444*	probably null	Het
Sspo	G	T	6: 48,482,664	W3319L	probably damaging	Het
Usp6nl	A	G	2: 6,427,793	I326V	possibly damaging	Het
Zcchc17	T	C	4: 130,316,733	K214E	possibly damaging	Het
Zfp638	C	A	6: 83,979,765	H1785N	probably benign	Het

Other mutations in Ugt2b5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00702:Ugt2b5	APN	5	87125219	missense	probably benign	0.02
IGL00742:Ugt2b5	APN	5	87127814	missense	probably damaging	1.00
IGL01527:Ugt2b5	APN	5	87136209	missense	possibly damaging	0.71
IGL01530:Ugt2b5	APN	5	87137245	missense	probably benign	0.08
IGL01637:Ugt2b5	APN	5	87139900	missense	probably benign	0.04
IGL02371:Ugt2b5	APN	5	87127676	critical splice donor site	probably null
IGL02993:Ugt2b5	APN	5	87137232	missense	probably damaging	1.00
IGL03114:Ugt2b5	APN	5	87128350	missense	probably damaging	1.00
R0372:Ugt2b5	UTSW	5	87140258	missense	probably benign	0.05
R0568:Ugt2b5	UTSW	5	87137365	critical splice acceptor site	probably benign
R0650:Ugt2b5	UTSW	5	87139768	missense	probably benign	0.00
R1660:Ugt2b5	UTSW	5	87139618	missense	probably benign	0.00
R1907:Ugt2b5	UTSW	5	87139630	missense	probably benign	0.19
R1955:Ugt2b5	UTSW	5	87127772	missense	probably benign	0.18
R2389:Ugt2b5	UTSW	5	87127682	missense	probably damaging	0.98
R2435:Ugt2b5	UTSW	5	87139606	missense	probably damaging	0.99
R2919:Ugt2b5	UTSW	5	87125407	missense	possibly damaging	0.83
R2920:Ugt2b5	UTSW	5	87125407	missense	possibly damaging	0.83
R4342:Ugt2b5	UTSW	5	87139723	missense	probably damaging	1.00
R4343:Ugt2b5	UTSW	5	87139723	missense	probably damaging	1.00
R4344:Ugt2b5	UTSW	5	87139723	missense	probably damaging	1.00
R4355:Ugt2b5	UTSW	5	87139763	nonsense	probably null
R4380:Ugt2b5	UTSW	5	87127894	missense	probably damaging	1.00
R4789:Ugt2b5	UTSW	5	87139691	missense	probably benign	0.14
R4993:Ugt2b5	UTSW	5	87139673	missense	probably benign	0.00
R5731:Ugt2b5	UTSW	5	87140252	nonsense	probably null
R6035:Ugt2b5	UTSW	5	87139682	missense	probably benign	0.09
R6035:Ugt2b5	UTSW	5	87139682	missense	probably benign	0.09
R6491:Ugt2b5	UTSW	5	87125469	nonsense	probably null
R7015:Ugt2b5	UTSW	5	87139796	missense	probably damaging	1.00
R7203:Ugt2b5	UTSW	5	87128399	missense	possibly damaging	0.72
R7212:Ugt2b5	UTSW	5	87125272	missense	probably benign	0.06
R7750:Ugt2b5	UTSW	5	87140249	missense	probably benign	0.11
R8465:Ugt2b5	UTSW	5	87139659	missense	possibly damaging	0.79
R9336:Ugt2b5	UTSW	5	87137271	missense	probably benign	0.00
X0004:Ugt2b5	UTSW	5	87128371	nonsense	probably null
X0021:Ugt2b5	UTSW	5	87136211	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- TCCTGTAGCTTTGTCATGAGC -3'
(R):5'- TGCTGCTGCAGATAAGTTGC -3'

Sequencing Primer
(F):5'- TGTCATGAGCTCTTTGTTTGAAAC -3'
(R):5'- CTGCAGATAAGTTGCTGCTTCAGATC -3'

Posted On

2020-09-02