Incidental Mutation 'R8384:Lnx2'
ID 647074
Institutional Source Beutler Lab
Gene Symbol Lnx2
Ensembl Gene ENSMUSG00000016520
Gene Name ligand of numb-protein X 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock # R8384 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 147016655-147076586 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 147029328 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 327 (A327V)
Ref Sequence ENSEMBL: ENSMUSP00000016664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016664]
AlphaFold Q91XL2
Predicted Effect probably benign
Transcript: ENSMUST00000016664
AA Change: A327V

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000016664
Gene: ENSMUSG00000016520
AA Change: A327V

DomainStartEndE-ValueType
RING 51 88 2.06e-6 SMART
low complexity region 103 114 N/A INTRINSIC
PDZ 242 317 2.25e-17 SMART
PDZ 348 421 2.97e-17 SMART
PDZ 474 553 7.37e-13 SMART
PDZ 606 683 1.27e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,166,765 D736G probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Col6a6 C T 9: 105,755,694 G1457D probably damaging Het
Colec11 A T 12: 28,594,659 *279R probably null Het
Ctnnbl1 A T 2: 157,818,060 E278V probably benign Het
Cyp24a1 A G 2: 170,486,769 probably null Het
D1Ertd622e A G 1: 97,645,930 C137R possibly damaging Het
Dpp6 A T 5: 27,718,474 Y694F probably benign Het
Eif5 A G 12: 111,539,805 E26G possibly damaging Het
Fhdc1 T C 3: 84,454,999 I305V possibly damaging Het
Flvcr2 T C 12: 85,796,193 F347S possibly damaging Het
Gm9803 A T 10: 43,524,351 I34F probably damaging Het
Hacl1 A G 14: 31,634,197 probably null Het
Hells A G 19: 38,959,122 T667A probably benign Het
Idua A G 5: 108,681,439 T416A possibly damaging Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Mdn1 T C 4: 32,765,680 V5220A probably benign Het
Mpst T A 15: 78,413,575 C264* probably null Het
Msh5 A G 17: 35,030,637 L644P probably damaging Het
Myo5b A G 18: 74,742,202 Y1533C probably damaging Het
Naa38 A G 11: 69,395,926 E12G probably benign Het
Obscn C A 11: 59,085,109 C2064F probably damaging Het
Olfr470 A T 7: 107,845,258 N158K possibly damaging Het
Olfr782 A T 10: 129,350,826 K88* probably null Het
Ralgds G T 2: 28,547,170 A534S probably damaging Het
Rgs22 A T 15: 36,046,012 probably null Het
Serpinb3c T C 1: 107,271,967 T275A probably benign Het
Slc7a13 T C 4: 19,823,984 V251A probably damaging Het
Snx14 C A 9: 88,403,280 E444* probably null Het
Sspo G T 6: 48,482,664 W3319L probably damaging Het
Ugt2b5 A G 5: 87,140,065 V81A probably benign Het
Usp6nl A G 2: 6,427,793 I326V possibly damaging Het
Zcchc17 T C 4: 130,316,733 K214E possibly damaging Het
Zfp638 C A 6: 83,979,765 H1785N probably benign Het
Other mutations in Lnx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02593:Lnx2 APN 5 147033015 missense possibly damaging 0.81
IGL02657:Lnx2 APN 5 147028174 missense probably damaging 1.00
IGL02820:Lnx2 APN 5 147042067 missense probably damaging 0.98
R0051:Lnx2 UTSW 5 147029353 missense probably damaging 0.96
R0389:Lnx2 UTSW 5 147019040 missense possibly damaging 0.51
R0482:Lnx2 UTSW 5 147018961 missense probably damaging 0.99
R1601:Lnx2 UTSW 5 147033519 missense probably damaging 0.99
R1604:Lnx2 UTSW 5 147029325 missense probably benign 0.02
R1647:Lnx2 UTSW 5 147027342 missense probably benign 0.04
R3001:Lnx2 UTSW 5 147019015 missense probably benign 0.00
R3002:Lnx2 UTSW 5 147019015 missense probably benign 0.00
R4734:Lnx2 UTSW 5 147029137 missense probably damaging 1.00
R4960:Lnx2 UTSW 5 147019040 missense probably benign 0.09
R5387:Lnx2 UTSW 5 147028154 missense probably benign 0.00
R5689:Lnx2 UTSW 5 147029151 missense probably damaging 1.00
R5950:Lnx2 UTSW 5 147024350 critical splice donor site probably null
R6161:Lnx2 UTSW 5 147042026 splice site probably null
R6623:Lnx2 UTSW 5 147024487 missense probably damaging 1.00
R7086:Lnx2 UTSW 5 147020178 splice site probably null
R7320:Lnx2 UTSW 5 147020133 missense possibly damaging 0.71
R7701:Lnx2 UTSW 5 147024523 missense probably damaging 1.00
R7887:Lnx2 UTSW 5 147019043 missense probably damaging 1.00
R8153:Lnx2 UTSW 5 147028096 missense probably benign
R8267:Lnx2 UTSW 5 147029091 missense probably damaging 1.00
R8298:Lnx2 UTSW 5 147024517 missense probably benign 0.05
R8446:Lnx2 UTSW 5 147033359 missense probably benign
R8971:Lnx2 UTSW 5 147033426 missense probably benign
R9378:Lnx2 UTSW 5 147024370 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCATTGCTGTTGAGCCTGCC -3'
(R):5'- TTCCTTTGGAGATGTCATCTGGAC -3'

Sequencing Primer
(F):5'- TTGAGCCTGCCGTCCTGTG -3'
(R):5'- GTCATCTGGACATTTCTGCAAG -3'
Posted On 2020-09-02