Incidental Mutation 'R8384:Olfr470'
ID647077
Institutional Source Beutler Lab
Gene Symbol Olfr470
Ensembl Gene ENSMUSG00000109542
Gene Nameolfactory receptor 470
SynonymsMOR204-22, GA_x6K02T2PBJ9-10175273-10174329
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R8384 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location107842905-107847490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107845258 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 158 (N158K)
Ref Sequence ENSEMBL: ENSMUSP00000151543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073059] [ENSMUST00000220193]
Predicted Effect possibly damaging
Transcript: ENSMUST00000073059
AA Change: N158K

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072810
Gene: ENSMUSG00000109542
AA Change: N158K

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2e-56 PFAM
Pfam:7tm_1 44 293 2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000220193
AA Change: N158K

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,166,765 D736G probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Col6a6 C T 9: 105,755,694 G1457D probably damaging Het
Colec11 A T 12: 28,594,659 *279R probably null Het
Ctnnbl1 A T 2: 157,818,060 E278V probably benign Het
Cyp24a1 A G 2: 170,486,769 probably null Het
D1Ertd622e A G 1: 97,645,930 C137R possibly damaging Het
Dpp6 A T 5: 27,718,474 Y694F probably benign Het
Eif5 A G 12: 111,539,805 E26G possibly damaging Het
Fhdc1 T C 3: 84,454,999 I305V possibly damaging Het
Flvcr2 T C 12: 85,796,193 F347S possibly damaging Het
Gm9803 A T 10: 43,524,351 I34F probably damaging Het
Hacl1 A G 14: 31,634,197 probably null Het
Hells A G 19: 38,959,122 T667A probably benign Het
Idua A G 5: 108,681,439 T416A possibly damaging Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Lnx2 G A 5: 147,029,328 A327V probably benign Het
Mdn1 T C 4: 32,765,680 V5220A probably benign Het
Mpst T A 15: 78,413,575 C264* probably null Het
Msh5 A G 17: 35,030,637 L644P probably damaging Het
Myo5b A G 18: 74,742,202 Y1533C probably damaging Het
Naa38 A G 11: 69,395,926 E12G probably benign Het
Obscn C A 11: 59,085,109 C2064F probably damaging Het
Olfr782 A T 10: 129,350,826 K88* probably null Het
Ralgds G T 2: 28,547,170 A534S probably damaging Het
Rgs22 A T 15: 36,046,012 probably null Het
Serpinb3c T C 1: 107,271,967 T275A probably benign Het
Slc7a13 T C 4: 19,823,984 V251A probably damaging Het
Snx14 C A 9: 88,403,280 E444* probably null Het
Sspo G T 6: 48,482,664 W3319L probably damaging Het
Ugt2b5 A G 5: 87,140,065 V81A probably benign Het
Usp6nl A G 2: 6,427,793 I326V possibly damaging Het
Zcchc17 T C 4: 130,316,733 K214E possibly damaging Het
Zfp638 C A 6: 83,979,765 H1785N probably benign Het
Other mutations in Olfr470
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Olfr470 APN 7 107845178 missense probably benign 0.00
IGL02349:Olfr470 APN 7 107845605 missense probably benign 0.03
IGL02365:Olfr470 APN 7 107844912 missense probably damaging 1.00
R0070:Olfr470 UTSW 7 107844917 missense probably damaging 0.99
R0540:Olfr470 UTSW 7 107845569 missense probably damaging 0.98
R0607:Olfr470 UTSW 7 107845569 missense probably damaging 0.98
R0624:Olfr470 UTSW 7 107845116 missense possibly damaging 0.87
R1983:Olfr470 UTSW 7 107845412 missense probably benign 0.36
R2420:Olfr470 UTSW 7 107844818 missense probably benign 0.03
R2441:Olfr470 UTSW 7 107844978 missense probably benign 0.10
R4395:Olfr470 UTSW 7 107845262 missense probably damaging 1.00
R4734:Olfr470 UTSW 7 107845428 missense probably benign 0.00
R4779:Olfr470 UTSW 7 107845548 missense possibly damaging 0.96
R5874:Olfr470 UTSW 7 107845170 missense probably benign
R6598:Olfr470 UTSW 7 107845263 missense probably benign 0.06
R6807:Olfr470 UTSW 7 107845590 missense possibly damaging 0.67
R6820:Olfr470 UTSW 7 107845091 missense probably benign 0.01
R7305:Olfr470 UTSW 7 107845365 missense probably damaging 1.00
R7413:Olfr470 UTSW 7 107845514 missense probably damaging 1.00
R7954:Olfr470 UTSW 7 107844912 missense probably benign 0.01
R8215:Olfr470 UTSW 7 107844917 missense probably damaging 0.99
R8255:Olfr470 UTSW 7 107845161 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTATGACAGACACTGTGAC -3'
(R):5'- AAATGCTTGCCAACTTCCTG -3'

Sequencing Primer
(F):5'- CACTGTGACTATAATGACAAAGGC -3'
(R):5'- AAGCACAATCTCCTACCTTGGGTG -3'
Posted On2020-09-02