Incidental Mutation 'R8384:Flvcr2'
ID647086
Institutional Source Beutler Lab
Gene Symbol Flvcr2
Ensembl Gene ENSMUSG00000034258
Gene Namefeline leukemia virus subgroup C cellular receptor 2
SynonymsMfsd7c, CCT
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.914) question?
Stock #R8384 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location85746539-85813585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85796193 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 347 (F347S)
Ref Sequence ENSEMBL: ENSMUSP00000035569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040461]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040461
AA Change: F347S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035569
Gene: ENSMUSG00000034258
AA Change: F347S

DomainStartEndE-ValueType
Pfam:MFS_1 113 477 1.7e-30 PFAM
transmembrane domain 488 510 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the major facilitator superfamily. The encoded transmembrane protein is a calcium transporter. Unlike the related protein feline leukemia virus subgroup C receptor 1, the protein encoded by this locus does not bind to feline leukemia virus subgroup C envelope protein. The encoded protein may play a role in development of brain vascular endothelial cells, as mutations at this locus have been associated with proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome. Alternatively spliced transcript variants have been described.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,166,765 D736G probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Col6a6 C T 9: 105,755,694 G1457D probably damaging Het
Colec11 A T 12: 28,594,659 *279R probably null Het
Ctnnbl1 A T 2: 157,818,060 E278V probably benign Het
Cyp24a1 A G 2: 170,486,769 probably null Het
D1Ertd622e A G 1: 97,645,930 C137R possibly damaging Het
Dpp6 A T 5: 27,718,474 Y694F probably benign Het
Eif5 A G 12: 111,539,805 E26G possibly damaging Het
Fhdc1 T C 3: 84,454,999 I305V possibly damaging Het
Gm9803 A T 10: 43,524,351 I34F probably damaging Het
Hacl1 A G 14: 31,634,197 probably null Het
Hells A G 19: 38,959,122 T667A probably benign Het
Idua A G 5: 108,681,439 T416A possibly damaging Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Lnx2 G A 5: 147,029,328 A327V probably benign Het
Mdn1 T C 4: 32,765,680 V5220A probably benign Het
Mpst T A 15: 78,413,575 C264* probably null Het
Msh5 A G 17: 35,030,637 L644P probably damaging Het
Myo5b A G 18: 74,742,202 Y1533C probably damaging Het
Naa38 A G 11: 69,395,926 E12G probably benign Het
Obscn C A 11: 59,085,109 C2064F probably damaging Het
Olfr470 A T 7: 107,845,258 N158K possibly damaging Het
Olfr782 A T 10: 129,350,826 K88* probably null Het
Ralgds G T 2: 28,547,170 A534S probably damaging Het
Rgs22 A T 15: 36,046,012 probably null Het
Serpinb3c T C 1: 107,271,967 T275A probably benign Het
Slc7a13 T C 4: 19,823,984 V251A probably damaging Het
Snx14 C A 9: 88,403,280 E444* probably null Het
Sspo G T 6: 48,482,664 W3319L probably damaging Het
Ugt2b5 A G 5: 87,140,065 V81A probably benign Het
Usp6nl A G 2: 6,427,793 I326V possibly damaging Het
Zcchc17 T C 4: 130,316,733 K214E possibly damaging Het
Zfp638 C A 6: 83,979,765 H1785N probably benign Het
Other mutations in Flvcr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Flvcr2 APN 12 85747323 missense possibly damaging 0.91
IGL01461:Flvcr2 APN 12 85803131 splice site probably benign
IGL02191:Flvcr2 APN 12 85786192 nonsense probably null
IGL02643:Flvcr2 APN 12 85796223 missense possibly damaging 0.96
IGL02933:Flvcr2 APN 12 85803128 splice site probably benign
pulga UTSW 12 85747191 missense possibly damaging 0.94
R1792:Flvcr2 UTSW 12 85747155 nonsense probably null
R1840:Flvcr2 UTSW 12 85803221 missense possibly damaging 0.91
R2402:Flvcr2 UTSW 12 85783003 missense probably benign 0.12
R4120:Flvcr2 UTSW 12 85786129 missense probably benign 0.31
R4900:Flvcr2 UTSW 12 85782982 missense probably damaging 0.98
R5417:Flvcr2 UTSW 12 85747191 missense probably damaging 0.97
R5559:Flvcr2 UTSW 12 85804407 missense probably benign 0.21
R5639:Flvcr2 UTSW 12 85747476 missense probably benign 0.03
R5891:Flvcr2 UTSW 12 85796228 missense possibly damaging 0.74
R6347:Flvcr2 UTSW 12 85747420 missense possibly damaging 0.66
R6349:Flvcr2 UTSW 12 85747200 missense probably benign 0.30
R7082:Flvcr2 UTSW 12 85746954 missense probably benign 0.03
R7179:Flvcr2 UTSW 12 85747191 missense possibly damaging 0.94
R7241:Flvcr2 UTSW 12 85805239 missense probably benign
R7459:Flvcr2 UTSW 12 85747057 missense probably benign 0.14
R8030:Flvcr2 UTSW 12 85798538 missense probably damaging 0.97
RF013:Flvcr2 UTSW 12 85747186 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGAAAGTTGCCTCATACATCC -3'
(R):5'- AAATTGAGACCCAGGGCCATC -3'

Sequencing Primer
(F):5'- ACATCCCTGAATTTTTCTCCTCCGAG -3'
(R):5'- GACCCAGGGCCATCTACCTC -3'
Posted On2020-09-02