Mutagenetix > Incidental Mutations

Incidental Mutation 'R8384:Flvcr2'

647086

Institutional Source

Beutler Lab

Gene Symbol

Flvcr2

Ensembl Gene

ENSMUSG00000034258

Gene Name

feline leukemia virus subgroup C cellular receptor 2

Synonyms

Mfsd7c, CCT

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.914) question?

Stock #

R8384 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

85746539-85813585 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 85796193 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 347 (F347S)

Ref Sequence

ENSEMBL: ENSMUSP00000035569 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040461]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000040461
AA Change: F347S

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000035569
Gene: ENSMUSG00000034258
AA Change: F347S

Domain	Start	End	E-Value	Type
Pfam:MFS_1	113	477	1.7e-30	PFAM
transmembrane domain	488	510	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the major facilitator superfamily. The encoded transmembrane protein is a calcium transporter. Unlike the related protein feline leukemia virus subgroup C receptor 1, the protein encoded by this locus does not bind to feline leukemia virus subgroup C envelope protein. The encoded protein may play a role in development of brain vascular endothelial cells, as mutations at this locus have been associated with proliferative vasculopathy and hydranencephaly-hydrocephaly syndrome. Alternatively spliced transcript variants have been described.[provided by RefSeq, Aug 2010]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	T	C	11: 72,166,765	D736G	probably benign	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Col6a6	C	T	9: 105,755,694	G1457D	probably damaging	Het
Colec11	A	T	12: 28,594,659	*279R	probably null	Het
Ctnnbl1	A	T	2: 157,818,060	E278V	probably benign	Het
Cyp24a1	A	G	2: 170,486,769		probably null	Het
D1Ertd622e	A	G	1: 97,645,930	C137R	possibly damaging	Het
Dpp6	A	T	5: 27,718,474	Y694F	probably benign	Het
Eif5	A	G	12: 111,539,805	E26G	possibly damaging	Het
Fhdc1	T	C	3: 84,454,999	I305V	possibly damaging	Het
Gm9803	A	T	10: 43,524,351	I34F	probably damaging	Het
Hacl1	A	G	14: 31,634,197		probably null	Het
Hells	A	G	19: 38,959,122	T667A	probably benign	Het
Idua	A	G	5: 108,681,439	T416A	possibly damaging	Het
Lfng	G	A	5: 140,613,226	E297K	probably damaging	Het
Lnx2	G	A	5: 147,029,328	A327V	probably benign	Het
Mdn1	T	C	4: 32,765,680	V5220A	probably benign	Het
Mpst	T	A	15: 78,413,575	C264*	probably null	Het
Msh5	A	G	17: 35,030,637	L644P	probably damaging	Het
Myo5b	A	G	18: 74,742,202	Y1533C	probably damaging	Het
Naa38	A	G	11: 69,395,926	E12G	probably benign	Het
Obscn	C	A	11: 59,085,109	C2064F	probably damaging	Het
Olfr470	A	T	7: 107,845,258	N158K	possibly damaging	Het
Olfr782	A	T	10: 129,350,826	K88*	probably null	Het
Ralgds	G	T	2: 28,547,170	A534S	probably damaging	Het
Rgs22	A	T	15: 36,046,012		probably null	Het
Serpinb3c	T	C	1: 107,271,967	T275A	probably benign	Het
Slc7a13	T	C	4: 19,823,984	V251A	probably damaging	Het
Snx14	C	A	9: 88,403,280	E444*	probably null	Het
Sspo	G	T	6: 48,482,664	W3319L	probably damaging	Het
Ugt2b5	A	G	5: 87,140,065	V81A	probably benign	Het
Usp6nl	A	G	2: 6,427,793	I326V	possibly damaging	Het
Zcchc17	T	C	4: 130,316,733	K214E	possibly damaging	Het
Zfp638	C	A	6: 83,979,765	H1785N	probably benign	Het

Other mutations in Flvcr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00555:Flvcr2	APN	12	85747323	missense	possibly damaging	0.91
IGL01461:Flvcr2	APN	12	85803131	splice site	probably benign
IGL02191:Flvcr2	APN	12	85786192	nonsense	probably null
IGL02643:Flvcr2	APN	12	85796223	missense	possibly damaging	0.96
IGL02933:Flvcr2	APN	12	85803128	splice site	probably benign
pulga	UTSW	12	85747191	missense	possibly damaging	0.94
R1792:Flvcr2	UTSW	12	85747155	nonsense	probably null
R1840:Flvcr2	UTSW	12	85803221	missense	possibly damaging	0.91
R2402:Flvcr2	UTSW	12	85783003	missense	probably benign	0.12
R4120:Flvcr2	UTSW	12	85786129	missense	probably benign	0.31
R4900:Flvcr2	UTSW	12	85782982	missense	probably damaging	0.98
R5417:Flvcr2	UTSW	12	85747191	missense	probably damaging	0.97
R5559:Flvcr2	UTSW	12	85804407	missense	probably benign	0.21
R5639:Flvcr2	UTSW	12	85747476	missense	probably benign	0.03
R5891:Flvcr2	UTSW	12	85796228	missense	possibly damaging	0.74
R6347:Flvcr2	UTSW	12	85747420	missense	possibly damaging	0.66
R6349:Flvcr2	UTSW	12	85747200	missense	probably benign	0.30
R7082:Flvcr2	UTSW	12	85746954	missense	probably benign	0.03
R7179:Flvcr2	UTSW	12	85747191	missense	possibly damaging	0.94
R7241:Flvcr2	UTSW	12	85805239	missense	probably benign
R7459:Flvcr2	UTSW	12	85747057	missense	probably benign	0.14
R8030:Flvcr2	UTSW	12	85798538	missense	probably damaging	0.97
RF013:Flvcr2	UTSW	12	85747186	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAGAAAGTTGCCTCATACATCC -3'
(R):5'- AAATTGAGACCCAGGGCCATC -3'

Sequencing Primer
(F):5'- ACATCCCTGAATTTTTCTCCTCCGAG -3'
(R):5'- GACCCAGGGCCATCTACCTC -3'

Posted On

2020-09-02