Incidental Mutation 'R8384:Myo5b'
ID647093
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Namemyosin VB
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.782) question?
Stock #R8384 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location74440936-74771493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74742202 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1533 (Y1533C)
Ref Sequence ENSEMBL: ENSMUSP00000073790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
Predicted Effect probably damaging
Transcript: ENSMUST00000074157
AA Change: Y1533C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: Y1533C

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121875
AA Change: Y1559C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: Y1559C

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T C 11: 72,166,765 D736G probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Col6a6 C T 9: 105,755,694 G1457D probably damaging Het
Colec11 A T 12: 28,594,659 *279R probably null Het
Ctnnbl1 A T 2: 157,818,060 E278V probably benign Het
Cyp24a1 A G 2: 170,486,769 probably null Het
D1Ertd622e A G 1: 97,645,930 C137R possibly damaging Het
Dpp6 A T 5: 27,718,474 Y694F probably benign Het
Eif5 A G 12: 111,539,805 E26G possibly damaging Het
Fhdc1 T C 3: 84,454,999 I305V possibly damaging Het
Flvcr2 T C 12: 85,796,193 F347S possibly damaging Het
Gm9803 A T 10: 43,524,351 I34F probably damaging Het
Hacl1 A G 14: 31,634,197 probably null Het
Hells A G 19: 38,959,122 T667A probably benign Het
Idua A G 5: 108,681,439 T416A possibly damaging Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Lnx2 G A 5: 147,029,328 A327V probably benign Het
Mdn1 T C 4: 32,765,680 V5220A probably benign Het
Mpst T A 15: 78,413,575 C264* probably null Het
Msh5 A G 17: 35,030,637 L644P probably damaging Het
Naa38 A G 11: 69,395,926 E12G probably benign Het
Obscn C A 11: 59,085,109 C2064F probably damaging Het
Olfr470 A T 7: 107,845,258 N158K possibly damaging Het
Olfr782 A T 10: 129,350,826 K88* probably null Het
Ralgds G T 2: 28,547,170 A534S probably damaging Het
Rgs22 A T 15: 36,046,012 probably null Het
Serpinb3c T C 1: 107,271,967 T275A probably benign Het
Slc7a13 T C 4: 19,823,984 V251A probably damaging Het
Snx14 C A 9: 88,403,280 E444* probably null Het
Sspo G T 6: 48,482,664 W3319L probably damaging Het
Ugt2b5 A G 5: 87,140,065 V81A probably benign Het
Usp6nl A G 2: 6,427,793 I326V possibly damaging Het
Zcchc17 T C 4: 130,316,733 K214E possibly damaging Het
Zfp638 C A 6: 83,979,765 H1785N probably benign Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74654076 splice site probably benign
IGL01083:Myo5b APN 18 74733903 splice site probably benign
IGL01448:Myo5b APN 18 74644090 missense probably damaging 0.97
IGL01516:Myo5b APN 18 74627195 missense probably damaging 0.99
IGL01525:Myo5b APN 18 74740549 missense probably damaging 1.00
IGL01873:Myo5b APN 18 74580396 missense probably damaging 1.00
IGL01887:Myo5b APN 18 74714936 missense probably benign 0.41
IGL01953:Myo5b APN 18 74569767 missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74698277 missense probably damaging 1.00
IGL02017:Myo5b APN 18 74716999 missense probably damaging 1.00
IGL02331:Myo5b APN 18 74638040 critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74714939 missense probably damaging 0.98
IGL02707:Myo5b APN 18 74695367 splice site probably benign
IGL02806:Myo5b APN 18 74617080 critical splice donor site probably null
IGL03009:Myo5b APN 18 74760968 missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74634559 missense probably benign 0.02
IGL03061:Myo5b APN 18 74580544 splice site probably benign
unrat UTSW 18 74653361 missense possibly damaging 0.93
BB007:Myo5b UTSW 18 74731754 missense probably benign
BB017:Myo5b UTSW 18 74731754 missense probably benign
R0085:Myo5b UTSW 18 74701680 missense probably benign 0.21
R0114:Myo5b UTSW 18 74742171 missense probably benign 0.03
R0226:Myo5b UTSW 18 74742180 missense probably benign
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74728954 splice site probably benign
R0494:Myo5b UTSW 18 74653967 missense probably damaging 1.00
R0920:Myo5b UTSW 18 74625641 missense probably benign 0.09
R1144:Myo5b UTSW 18 74625587 missense probably damaging 1.00
R1177:Myo5b UTSW 18 74644072 missense probably damaging 1.00
R1387:Myo5b UTSW 18 74644201 splice site probably benign
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1555:Myo5b UTSW 18 74569782 missense probably damaging 1.00
R1587:Myo5b UTSW 18 74733990 missense probably benign
R1600:Myo5b UTSW 18 74713540 unclassified probably benign
R1639:Myo5b UTSW 18 74707916 missense probably benign 0.19
R1779:Myo5b UTSW 18 74742147 missense probably benign 0.06
R1806:Myo5b UTSW 18 74577609 missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2046:Myo5b UTSW 18 74577455 missense probably benign 0.28
R2093:Myo5b UTSW 18 74759192 missense probably damaging 0.98
R2270:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2272:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2298:Myo5b UTSW 18 74625605 missense probably damaging 1.00
R2433:Myo5b UTSW 18 74759087 missense probably damaging 1.00
R2888:Myo5b UTSW 18 74762618 missense probably damaging 1.00
R3824:Myo5b UTSW 18 74661655 missense probably benign 0.41
R3937:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3938:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3947:Myo5b UTSW 18 74695403 missense probably damaging 1.00
R3971:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3972:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3974:Myo5b UTSW 18 74634481 missense probably damaging 1.00
R4027:Myo5b UTSW 18 74759240 missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74740488 missense probably benign
R4285:Myo5b UTSW 18 74714849 missense probably benign
R4308:Myo5b UTSW 18 74731740 missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74698274 missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74580408 missense probably damaging 1.00
R4516:Myo5b UTSW 18 74625674 missense probably damaging 1.00
R4690:Myo5b UTSW 18 74722462 missense probably damaging 0.97
R4781:Myo5b UTSW 18 74744681 missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74695380 missense probably benign 0.01
R4796:Myo5b UTSW 18 74744630 missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74695384 missense probably benign 0.19
R4972:Myo5b UTSW 18 74627193 missense probably damaging 0.98
R5004:Myo5b UTSW 18 74744773 critical splice donor site probably null
R5024:Myo5b UTSW 18 74716034 missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74638153 critical splice donor site probably null
R5187:Myo5b UTSW 18 74701674 missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74714932 missense probably damaging 0.99
R5254:Myo5b UTSW 18 74700606 missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74662670 missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74742175 missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74654057 missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74701521 missense probably benign
R5875:Myo5b UTSW 18 74707902 splice site probably null
R6088:Myo5b UTSW 18 74720898 missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74700679 missense probably benign 0.19
R6237:Myo5b UTSW 18 74742178 missense probably damaging 1.00
R6265:Myo5b UTSW 18 74577440 splice site probably null
R6267:Myo5b UTSW 18 74616991 missense probably damaging 1.00
R6328:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6330:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6331:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6347:Myo5b UTSW 18 74770385 missense probably benign 0.11
R6479:Myo5b UTSW 18 74617015 missense probably damaging 1.00
R6748:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74617035 missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74770325 missense probably benign
R6876:Myo5b UTSW 18 74707955 missense probably benign
R6880:Myo5b UTSW 18 74722430 missense probably benign 0.02
R6902:Myo5b UTSW 18 74676685 missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74653361 missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74701528 missense probably benign 0.01
R7162:Myo5b UTSW 18 74695427 missense probably benign 0.02
R7345:Myo5b UTSW 18 74708024 missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74731731 missense probably benign 0.00
R7564:Myo5b UTSW 18 74634511 missense possibly damaging 0.84
R7629:Myo5b UTSW 18 74627254 critical splice donor site probably null
R7635:Myo5b UTSW 18 74580396 missense probably damaging 1.00
R7670:Myo5b UTSW 18 74701446 missense probably benign 0.05
R7754:Myo5b UTSW 18 74634559 missense probably benign 0.02
R7930:Myo5b UTSW 18 74731754 missense probably benign
R8013:Myo5b UTSW 18 74760899 nonsense probably null
R8271:Myo5b UTSW 18 74627190 missense probably damaging 1.00
R8312:Myo5b UTSW 18 74733962 missense probably damaging 1.00
R8383:Myo5b UTSW 18 74643978 missense probably benign 0.05
RF009:Myo5b UTSW 18 74643999 missense probably damaging 1.00
Z1088:Myo5b UTSW 18 74744749 missense probably benign 0.35
Z1177:Myo5b UTSW 18 74617017 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AAAGATTAGCTCTGCTGGGACTG -3'
(R):5'- CCCAGTCTTGCAAAGAAAGGC -3'

Sequencing Primer
(F):5'- CCCAGGAATGCTGGGTAACAC -3'
(R):5'- AGGCATTCCCACAATCTGAGGTTC -3'
Posted On2020-09-02