Mutagenetix > Incidental Mutations

Incidental Mutation 'R8384:Myo5b'

647093

Institutional Source

Beutler Lab

Gene Symbol

Myo5b

Ensembl Gene

ENSMUSG00000025885

Gene Name

myosin VB

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.740) question?

Stock #

R8384 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

74440936-74771493 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 74742202 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1533 (Y1533C)

Ref Sequence

ENSEMBL: ENSMUSP00000073790 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000074157
AA Change: Y1533C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: Y1533C

Domain	Start	End	E-Value	Type
MYSc	63	763	N/A	SMART
IQ	764	786	2.41e-4	SMART
IQ	787	809	7.7e-3	SMART
IQ	812	834	2.18e-2	SMART
IQ	835	857	1.72e0	SMART
IQ	860	882	7.52e-6	SMART
IQ	883	905	4.12e-3	SMART
low complexity region	1053	1065	N/A	INTRINSIC
coiled coil region	1140	1261	N/A	INTRINSIC
coiled coil region	1311	1415	N/A	INTRINSIC
DIL	1650	1755	7.48e-51	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121875
AA Change: Y1559C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: Y1559C

Domain	Start	End	E-Value	Type
MYSc	63	763	N/A	SMART
IQ	764	786	2.41e-4	SMART
IQ	787	809	7.7e-3	SMART
IQ	812	834	2.18e-2	SMART
IQ	835	857	1.72e0	SMART
IQ	860	882	7.52e-6	SMART
IQ	883	905	4.12e-3	SMART
low complexity region	1053	1065	N/A	INTRINSIC
coiled coil region	1140	1261	N/A	INTRINSIC
coiled coil region	1332	1441	N/A	INTRINSIC
DIL	1676	1781	7.48e-51	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	T	C	11: 72,166,765	D736G	probably benign	Het
Celsr1	G	T	15: 86,033,085	S229*	probably null	Het
Col6a6	C	T	9: 105,755,694	G1457D	probably damaging	Het
Colec11	A	T	12: 28,594,659	*279R	probably null	Het
Ctnnbl1	A	T	2: 157,818,060	E278V	probably benign	Het
Cyp24a1	A	G	2: 170,486,769		probably null	Het
D1Ertd622e	A	G	1: 97,645,930	C137R	possibly damaging	Het
Dpp6	A	T	5: 27,718,474	Y694F	probably benign	Het
Eif5	A	G	12: 111,539,805	E26G	possibly damaging	Het
Fhdc1	T	C	3: 84,454,999	I305V	possibly damaging	Het
Flvcr2	T	C	12: 85,796,193	F347S	possibly damaging	Het
Gm9803	A	T	10: 43,524,351	I34F	probably damaging	Het
Hacl1	A	G	14: 31,634,197		probably null	Het
Hells	A	G	19: 38,959,122	T667A	probably benign	Het
Idua	A	G	5: 108,681,439	T416A	possibly damaging	Het
Lfng	G	A	5: 140,613,226	E297K	probably damaging	Het
Lnx2	G	A	5: 147,029,328	A327V	probably benign	Het
Mdn1	T	C	4: 32,765,680	V5220A	probably benign	Het
Mpst	T	A	15: 78,413,575	C264*	probably null	Het
Msh5	A	G	17: 35,030,637	L644P	probably damaging	Het
Naa38	A	G	11: 69,395,926	E12G	probably benign	Het
Obscn	C	A	11: 59,085,109	C2064F	probably damaging	Het
Olfr470	A	T	7: 107,845,258	N158K	possibly damaging	Het
Olfr782	A	T	10: 129,350,826	K88*	probably null	Het
Ralgds	G	T	2: 28,547,170	A534S	probably damaging	Het
Rgs22	A	T	15: 36,046,012		probably null	Het
Serpinb3c	T	C	1: 107,271,967	T275A	probably benign	Het
Slc7a13	T	C	4: 19,823,984	V251A	probably damaging	Het
Snx14	C	A	9: 88,403,280	E444*	probably null	Het
Sspo	G	T	6: 48,482,664	W3319L	probably damaging	Het
Ugt2b5	A	G	5: 87,140,065	V81A	probably benign	Het
Usp6nl	A	G	2: 6,427,793	I326V	possibly damaging	Het
Zcchc17	T	C	4: 130,316,733	K214E	possibly damaging	Het
Zfp638	C	A	6: 83,979,765	H1785N	probably benign	Het

Other mutations in Myo5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00798:Myo5b	APN	18	74654076	splice site	probably benign
IGL01083:Myo5b	APN	18	74733903	splice site	probably benign
IGL01448:Myo5b	APN	18	74644090	missense	probably damaging	0.97
IGL01516:Myo5b	APN	18	74627195	missense	probably damaging	0.99
IGL01525:Myo5b	APN	18	74740549	missense	probably damaging	1.00
IGL01873:Myo5b	APN	18	74580396	missense	probably damaging	1.00
IGL01887:Myo5b	APN	18	74714936	missense	probably benign	0.41
IGL01953:Myo5b	APN	18	74569767	missense	possibly damaging	0.62
IGL01976:Myo5b	APN	18	74698277	missense	probably damaging	1.00
IGL02017:Myo5b	APN	18	74716999	missense	probably damaging	1.00
IGL02331:Myo5b	APN	18	74638040	critical splice acceptor site	probably null
IGL02624:Myo5b	APN	18	74714939	missense	probably damaging	0.98
IGL02707:Myo5b	APN	18	74695367	splice site	probably benign
IGL02806:Myo5b	APN	18	74617080	critical splice donor site	probably null
IGL03009:Myo5b	APN	18	74760968	missense	possibly damaging	0.54
IGL03061:Myo5b	APN	18	74634559	missense	probably benign	0.02
IGL03061:Myo5b	APN	18	74580544	splice site	probably benign
unrat	UTSW	18	74653361	missense	possibly damaging	0.93
BB007:Myo5b	UTSW	18	74731754	missense	probably benign
BB017:Myo5b	UTSW	18	74731754	missense	probably benign
R0085:Myo5b	UTSW	18	74701680	missense	probably benign	0.21
R0114:Myo5b	UTSW	18	74742171	missense	probably benign	0.03
R0226:Myo5b	UTSW	18	74742180	missense	probably benign
R0242:Myo5b	UTSW	18	74661716	missense	possibly damaging	0.95
R0242:Myo5b	UTSW	18	74661716	missense	possibly damaging	0.95
R0471:Myo5b	UTSW	18	74728954	splice site	probably benign
R0494:Myo5b	UTSW	18	74653967	missense	probably damaging	1.00
R0920:Myo5b	UTSW	18	74625641	missense	probably benign	0.09
R1144:Myo5b	UTSW	18	74625587	missense	probably damaging	1.00
R1177:Myo5b	UTSW	18	74644072	missense	probably damaging	1.00
R1387:Myo5b	UTSW	18	74644201	splice site	probably benign
R1468:Myo5b	UTSW	18	74740503	missense	probably damaging	0.99
R1468:Myo5b	UTSW	18	74740503	missense	probably damaging	0.99
R1555:Myo5b	UTSW	18	74569782	missense	probably damaging	1.00
R1587:Myo5b	UTSW	18	74733990	missense	probably benign
R1600:Myo5b	UTSW	18	74713540	unclassified	probably benign
R1639:Myo5b	UTSW	18	74707916	missense	probably benign	0.19
R1779:Myo5b	UTSW	18	74742147	missense	probably benign	0.06
R1806:Myo5b	UTSW	18	74577609	missense	possibly damaging	0.91
R1929:Myo5b	UTSW	18	74733925	missense	probably damaging	0.99
R2046:Myo5b	UTSW	18	74577455	missense	probably benign	0.28
R2093:Myo5b	UTSW	18	74759192	missense	probably damaging	0.98
R2270:Myo5b	UTSW	18	74733925	missense	probably damaging	0.99
R2272:Myo5b	UTSW	18	74733925	missense	probably damaging	0.99
R2298:Myo5b	UTSW	18	74625605	missense	probably damaging	1.00
R2433:Myo5b	UTSW	18	74759087	missense	probably damaging	1.00
R2888:Myo5b	UTSW	18	74762618	missense	probably damaging	1.00
R3824:Myo5b	UTSW	18	74661655	missense	probably benign	0.41
R3937:Myo5b	UTSW	18	74716037	missense	probably damaging	0.98
R3938:Myo5b	UTSW	18	74716037	missense	probably damaging	0.98
R3947:Myo5b	UTSW	18	74695403	missense	probably damaging	1.00
R3971:Myo5b	UTSW	18	74740527	missense	probably damaging	1.00
R3972:Myo5b	UTSW	18	74740527	missense	probably damaging	1.00
R3974:Myo5b	UTSW	18	74634481	missense	probably damaging	1.00
R4027:Myo5b	UTSW	18	74759240	missense	possibly damaging	0.67
R4080:Myo5b	UTSW	18	74740488	missense	probably benign
R4285:Myo5b	UTSW	18	74714849	missense	probably benign
R4308:Myo5b	UTSW	18	74731740	missense	possibly damaging	0.89
R4411:Myo5b	UTSW	18	74698274	missense	possibly damaging	0.89
R4415:Myo5b	UTSW	18	74580408	missense	probably damaging	1.00
R4516:Myo5b	UTSW	18	74625674	missense	probably damaging	1.00
R4690:Myo5b	UTSW	18	74722462	missense	probably damaging	0.97
R4781:Myo5b	UTSW	18	74744681	missense	possibly damaging	0.80
R4786:Myo5b	UTSW	18	74695380	missense	probably benign	0.01
R4796:Myo5b	UTSW	18	74744630	missense	possibly damaging	0.68
R4924:Myo5b	UTSW	18	74695384	missense	probably benign	0.19
R4972:Myo5b	UTSW	18	74627193	missense	probably damaging	0.98
R5004:Myo5b	UTSW	18	74744773	critical splice donor site	probably null
R5024:Myo5b	UTSW	18	74716034	missense	possibly damaging	0.90
R5043:Myo5b	UTSW	18	74638153	critical splice donor site	probably null
R5187:Myo5b	UTSW	18	74701674	missense	possibly damaging	0.68
R5232:Myo5b	UTSW	18	74714932	missense	probably damaging	0.99
R5254:Myo5b	UTSW	18	74700606	missense	possibly damaging	0.65
R5255:Myo5b	UTSW	18	74662670	missense	possibly damaging	0.94
R5715:Myo5b	UTSW	18	74742175	missense	possibly damaging	0.88
R5733:Myo5b	UTSW	18	74654057	missense	possibly damaging	0.93
R5797:Myo5b	UTSW	18	74701521	missense	probably benign
R5875:Myo5b	UTSW	18	74707902	splice site	probably null
R6088:Myo5b	UTSW	18	74720898	missense	possibly damaging	0.89
R6104:Myo5b	UTSW	18	74700679	missense	probably benign	0.19
R6237:Myo5b	UTSW	18	74742178	missense	probably damaging	1.00
R6265:Myo5b	UTSW	18	74577440	splice site	probably null
R6267:Myo5b	UTSW	18	74616991	missense	probably damaging	1.00
R6328:Myo5b	UTSW	18	74616993	missense	probably damaging	1.00
R6330:Myo5b	UTSW	18	74616993	missense	probably damaging	1.00
R6331:Myo5b	UTSW	18	74616993	missense	probably damaging	1.00
R6347:Myo5b	UTSW	18	74770385	missense	probably benign	0.11
R6479:Myo5b	UTSW	18	74617015	missense	probably damaging	1.00
R6748:Myo5b	UTSW	18	74701503	missense	possibly damaging	0.80
R6749:Myo5b	UTSW	18	74701503	missense	possibly damaging	0.80
R6750:Myo5b	UTSW	18	74617035	missense	possibly damaging	0.74
R6833:Myo5b	UTSW	18	74770325	missense	probably benign
R6876:Myo5b	UTSW	18	74707955	missense	probably benign
R6880:Myo5b	UTSW	18	74722430	missense	probably benign	0.02
R6902:Myo5b	UTSW	18	74676685	missense	possibly damaging	0.95
R6985:Myo5b	UTSW	18	74653361	missense	possibly damaging	0.93
R7039:Myo5b	UTSW	18	74701528	missense	probably benign	0.01
R7162:Myo5b	UTSW	18	74695427	missense	probably benign	0.02
R7345:Myo5b	UTSW	18	74708024	missense	possibly damaging	0.82
R7530:Myo5b	UTSW	18	74731731	missense	probably benign	0.00
R7564:Myo5b	UTSW	18	74634511	missense	possibly damaging	0.84
R7629:Myo5b	UTSW	18	74627254	critical splice donor site	probably null
R7635:Myo5b	UTSW	18	74580396	missense	probably damaging	1.00
R7670:Myo5b	UTSW	18	74701446	missense	probably benign	0.05
R7754:Myo5b	UTSW	18	74634559	missense	probably benign	0.02
R7930:Myo5b	UTSW	18	74731754	missense	probably benign
R8013:Myo5b	UTSW	18	74760899	nonsense	probably null
R8271:Myo5b	UTSW	18	74627190	missense	probably damaging	1.00
R8312:Myo5b	UTSW	18	74733962	missense	probably damaging	1.00
R8383:Myo5b	UTSW	18	74643978	missense	probably benign	0.05
R8474:Myo5b	UTSW	18	74770340	missense	probably damaging	1.00
R8825:Myo5b	UTSW	18	74759098	missense	possibly damaging	0.79
R8846:Myo5b	UTSW	18	74707972	missense	probably benign	0.04
R9236:Myo5b	UTSW	18	74720863	missense	probably benign
R9283:Myo5b	UTSW	18	74644078	missense	probably benign	0.16
R9370:Myo5b	UTSW	18	74627175	missense	possibly damaging	0.54
RF009:Myo5b	UTSW	18	74643999	missense	probably damaging	1.00
Z1088:Myo5b	UTSW	18	74744749	missense	probably benign	0.35
Z1177:Myo5b	UTSW	18	74617017	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- AAAGATTAGCTCTGCTGGGACTG -3'
(R):5'- CCCAGTCTTGCAAAGAAAGGC -3'

Sequencing Primer
(F):5'- CCCAGGAATGCTGGGTAACAC -3'
(R):5'- AGGCATTCCCACAATCTGAGGTTC -3'

Posted On

2020-09-02