Incidental Mutation 'R8385:Hk2'
ID647115
Institutional Source Beutler Lab
Gene Symbol Hk2
Ensembl Gene ENSMUSG00000000628
Gene Namehexokinase 2
SynonymsHKII
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8385 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location82725025-82774454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82729546 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 792 (S792G)
Ref Sequence ENSEMBL: ENSMUSP00000000642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000642] [ENSMUST00000170833]
Predicted Effect probably benign
Transcript: ENSMUST00000000642
AA Change: S792G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000000642
Gene: ENSMUSG00000000628
AA Change: S792G

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 220 9.8e-78 PFAM
Pfam:Hexokinase_2 225 459 4.9e-85 PFAM
Pfam:Hexokinase_1 469 668 6.4e-80 PFAM
Pfam:Hexokinase_2 673 907 8.7e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170833
AA Change: S764G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125986
Gene: ENSMUSG00000000628
AA Change: S764G

DomainStartEndE-ValueType
Pfam:Hexokinase_1 1 193 5.5e-89 PFAM
Pfam:Hexokinase_2 195 434 5.3e-107 PFAM
Pfam:Hexokinase_1 436 641 5.9e-91 PFAM
Pfam:Hexokinase_2 643 882 1.3e-109 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes hexokinase 2, the predominant form found in skeletal muscle. It localizes to the outer membrane of mitochondria. Expression of this gene is insulin-responsive, and studies in rat suggest that it is involved in the increased rate of glycolysis seen in rapidly growing cancer cells. [provided by RefSeq, Apr 2009]
PHENOTYPE: Embryos homozygous for a knock-out mutation are severely growth retarded and die around E8.5. Interestingly, heterozygous mutant mice are viable and fertile, develop normally and do not exhibit impaired insulin action or glucose tolerance even when challenged with a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930572O03Rik A T 5: 15,652,671 S203T unknown Het
4933406M09Rik A G 1: 134,390,638 K383E probably benign Het
Brap C T 5: 121,685,134 T473I probably benign Het
Cacna1e T A 1: 154,443,941 M1400L probably damaging Het
Casc1 C T 6: 145,175,192 E685K probably damaging Het
Catsper2 A G 2: 121,410,140 I127T possibly damaging Het
Dbt A T 3: 116,523,390 I72F probably damaging Het
Ddhd2 T C 8: 25,735,014 H592R probably damaging Het
Disp2 T A 2: 118,790,410 M541K probably damaging Het
Dnmbp T C 19: 43,889,651 D327G probably benign Het
Dvl1 A G 4: 155,855,580 S390G possibly damaging Het
Fam205a1 C T 4: 42,850,509 R549H possibly damaging Het
Fbxo22 A G 9: 55,213,949 D106G probably damaging Het
Gfm2 A G 13: 97,165,011 T441A probably benign Het
Gm5431 T C 11: 48,889,520 I192V probably damaging Het
Gosr1 T A 11: 76,730,141 T241S possibly damaging Het
Itsn1 A C 16: 91,893,811 K1302Q unknown Het
Kif16b T C 2: 142,712,338 K847E probably benign Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Mark3 A G 12: 111,655,374 D650G possibly damaging Het
Mob3b T C 4: 34,985,980 Y186C probably damaging Het
Mphosph9 T C 5: 124,312,722 K329E probably benign Het
Mta1 A T 12: 113,131,465 M448L probably benign Het
Mterf1a A T 5: 3,891,384 N161K probably damaging Het
Myo10 T A 15: 25,804,398 I1593N probably damaging Het
Naca A G 10: 128,042,438 N1113S unknown Het
Olfr1362 T C 13: 21,611,352 I206V probably benign Het
Olfr513 T G 7: 108,755,304 Y149* probably null Het
Pcdhga1 A T 18: 37,662,096 D51V probably damaging Het
Peg3 T C 7: 6,708,083 E1380G probably damaging Het
Pkd1 G A 17: 24,575,728 V2130M possibly damaging Het
Pla2g4c C T 7: 13,329,664 P19S probably benign Het
Popdc2 G A 16: 38,362,900 V82I probably benign Het
Ppfibp2 A G 7: 107,697,687 R203G probably benign Het
Rab19 T A 6: 39,383,958 N13K probably benign Het
Raet1d T A 10: 22,370,918 D48E probably benign Het
Rell1 T A 5: 63,930,518 K136* probably null Het
Slc38a4 A G 15: 96,999,512 I474T probably damaging Het
Slf1 T C 13: 77,105,990 M243V probably benign Het
Spg11 A T 2: 122,097,321 S661T probably benign Het
Thra C G 11: 98,768,351 S435R probably benign Het
Tmem181a T C 17: 6,288,999 I61T probably benign Het
Ttpa G A 4: 20,028,483 G247S probably damaging Het
Usp17lb C T 7: 104,840,623 V366I possibly damaging Het
Vit A T 17: 78,619,637 Q337L probably benign Het
Vmn2r102 A G 17: 19,693,826 Y551C possibly damaging Het
Vps52 T C 17: 33,962,817 L539P probably damaging Het
Ythdc1 C A 5: 86,828,102 P529T possibly damaging Het
Zdhhc13 T C 7: 48,805,696 probably null Het
Zfp282 A T 6: 47,905,089 Y570F possibly damaging Het
Zfp872 A T 9: 22,200,111 K295N probably damaging Het
Other mutations in Hk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Hk2 APN 6 82729552 missense possibly damaging 0.93
IGL01484:Hk2 APN 6 82736730 missense probably damaging 1.00
IGL01786:Hk2 APN 6 82739553 missense probably benign 0.13
IGL02164:Hk2 APN 6 82743939 splice site probably null
IGL02293:Hk2 APN 6 82743975 missense probably benign 0.00
IGL02861:Hk2 APN 6 82760158 missense possibly damaging 0.73
IGL03029:Hk2 APN 6 82738333 missense probably damaging 1.00
IGL03063:Hk2 APN 6 82739649 missense probably damaging 1.00
IGL03063:Hk2 APN 6 82749232 missense probably benign 0.23
IGL02799:Hk2 UTSW 6 82760238 missense probably damaging 1.00
PIT4243001:Hk2 UTSW 6 82730877 missense probably damaging 1.00
R0069:Hk2 UTSW 6 82736528 critical splice donor site probably null
R0081:Hk2 UTSW 6 82734976 splice site probably benign
R0981:Hk2 UTSW 6 82743968 missense probably damaging 1.00
R1234:Hk2 UTSW 6 82760248 missense possibly damaging 0.95
R1239:Hk2 UTSW 6 82749308 missense probably damaging 1.00
R1695:Hk2 UTSW 6 82744951 missense probably damaging 0.99
R1891:Hk2 UTSW 6 82749283 missense probably benign 0.01
R2338:Hk2 UTSW 6 82731115 missense probably damaging 1.00
R3854:Hk2 UTSW 6 82736676 missense possibly damaging 0.87
R3855:Hk2 UTSW 6 82736676 missense possibly damaging 0.87
R3856:Hk2 UTSW 6 82736676 missense possibly damaging 0.87
R3887:Hk2 UTSW 6 82734961 missense possibly damaging 0.72
R4382:Hk2 UTSW 6 82735341 missense probably null 1.00
R4684:Hk2 UTSW 6 82739648 missense probably damaging 1.00
R4705:Hk2 UTSW 6 82739650 missense possibly damaging 0.95
R4735:Hk2 UTSW 6 82744974 missense probably benign 0.40
R5014:Hk2 UTSW 6 82743955 missense possibly damaging 0.73
R5552:Hk2 UTSW 6 82730823 missense possibly damaging 0.87
R5914:Hk2 UTSW 6 82736634 missense probably benign
R6212:Hk2 UTSW 6 82728842 missense probably benign 0.02
R6276:Hk2 UTSW 6 82743366 missense probably benign 0.05
R6369:Hk2 UTSW 6 82736753 missense probably damaging 1.00
R7175:Hk2 UTSW 6 82734849 missense probably benign 0.00
R7340:Hk2 UTSW 6 82728892 missense probably benign 0.00
R7383:Hk2 UTSW 6 82749295 missense probably damaging 1.00
R7417:Hk2 UTSW 6 82743345 missense probably damaging 1.00
R7481:Hk2 UTSW 6 82760169 missense probably benign 0.09
R7495:Hk2 UTSW 6 82727365 missense probably damaging 1.00
R7757:Hk2 UTSW 6 82742915 missense possibly damaging 0.88
R8023:Hk2 UTSW 6 82728809 missense probably benign 0.00
R8100:Hk2 UTSW 6 82730878 missense probably benign 0.14
R8504:Hk2 UTSW 6 82744866 missense possibly damaging 0.84
R8695:Hk2 UTSW 6 82739646 missense probably benign 0.02
R8808:Hk2 UTSW 6 82728766 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATCCTCAGAGTGGGTCTTTG -3'
(R):5'- ATGTTGCCTGCATGACTCTC -3'

Sequencing Primer
(F):5'- GGGGAGTGTCAGTTAGGAATG -3'
(R):5'- TGGACATAACCTCCGTGGAC -3'
Posted On2020-09-02