Incidental Mutation 'R8385:Casc1'
ID 647116
Institutional Source Beutler Lab
Gene Symbol Casc1
Ensembl Gene ENSMUSG00000043541
Gene Name cancer susceptibility candidate 1
Synonyms A230084G12Rik, Las1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R8385 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 145174834-145211005 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 145175192 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 685 (E685K)
Ref Sequence ENSEMBL: ENSMUSP00000062279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032396] [ENSMUST00000060797] [ENSMUST00000111728] [ENSMUST00000135984] [ENSMUST00000204105]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000032396
SMART Domains Protein: ENSMUSP00000032396
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 10 539 3.2e-265 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000060797
AA Change: E685K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062279
Gene: ENSMUSG00000043541
AA Change: E685K

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 5.5e-61 PFAM
Pfam:Casc1 241 469 3.4e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111728
AA Change: E634K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107357
Gene: ENSMUSG00000043541
AA Change: E634K

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
Pfam:Casc1 228 456 6.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132948
SMART Domains Protein: ENSMUSP00000120248
Gene: ENSMUSG00000030263

DomainStartEndE-ValueType
Pfam:MRVI1 8 504 3.7e-248 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135984
Predicted Effect probably benign
Transcript: ENSMUST00000204105
SMART Domains Protein: ENSMUSP00000144783
Gene: ENSMUSG00000043541

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 3.4e-57 PFAM
Pfam:Casc1 241 469 2.3e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice with disruptions of this gene display a higher incidence of lung tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930572O03Rik A T 5: 15,652,671 S203T unknown Het
4933406M09Rik A G 1: 134,390,638 K383E probably benign Het
Brap C T 5: 121,685,134 T473I probably benign Het
Cacna1e T A 1: 154,443,941 M1400L probably damaging Het
Catsper2 A G 2: 121,410,140 I127T possibly damaging Het
Dbt A T 3: 116,523,390 I72F probably damaging Het
Ddhd2 T C 8: 25,735,014 H592R probably damaging Het
Disp2 T A 2: 118,790,410 M541K probably damaging Het
Dnmbp T C 19: 43,889,651 D327G probably benign Het
Dvl1 A G 4: 155,855,580 S390G possibly damaging Het
Fam205a1 C T 4: 42,850,509 R549H possibly damaging Het
Fbxo22 A G 9: 55,213,949 D106G probably damaging Het
Gfm2 A G 13: 97,165,011 T441A probably benign Het
Gm5431 T C 11: 48,889,520 I192V probably damaging Het
Gosr1 T A 11: 76,730,141 T241S possibly damaging Het
Hk2 T C 6: 82,729,546 S792G probably benign Het
Itsn1 A C 16: 91,893,811 K1302Q unknown Het
Kif16b T C 2: 142,712,338 K847E probably benign Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Mark3 A G 12: 111,655,374 D650G possibly damaging Het
Mob3b T C 4: 34,985,980 Y186C probably damaging Het
Mphosph9 T C 5: 124,312,722 K329E probably benign Het
Mta1 A T 12: 113,131,465 M448L probably benign Het
Mterf1a A T 5: 3,891,384 N161K probably damaging Het
Myo10 T A 15: 25,804,398 I1593N probably damaging Het
Naca A G 10: 128,042,438 N1113S unknown Het
Olfr1362 T C 13: 21,611,352 I206V probably benign Het
Olfr513 T G 7: 108,755,304 Y149* probably null Het
Pcdhga1 A T 18: 37,662,096 D51V probably damaging Het
Peg3 T C 7: 6,708,083 E1380G probably damaging Het
Pkd1 G A 17: 24,575,728 V2130M possibly damaging Het
Pla2g4c C T 7: 13,329,664 P19S probably benign Het
Popdc2 G A 16: 38,362,900 V82I probably benign Het
Ppfibp2 A G 7: 107,697,687 R203G probably benign Het
Rab19 T A 6: 39,383,958 N13K probably benign Het
Raet1d T A 10: 22,370,918 D48E probably benign Het
Rell1 T A 5: 63,930,518 K136* probably null Het
Slc38a4 A G 15: 96,999,512 I474T probably damaging Het
Slf1 T C 13: 77,105,990 M243V probably benign Het
Spg11 A T 2: 122,097,321 S661T probably benign Het
Thra C G 11: 98,768,351 S435R probably benign Het
Tmem181a T C 17: 6,288,999 I61T probably benign Het
Ttpa G A 4: 20,028,483 G247S probably damaging Het
Usp17lb C T 7: 104,840,623 V366I possibly damaging Het
Vit A T 17: 78,619,637 Q337L probably benign Het
Vmn2r102 A G 17: 19,693,826 Y551C possibly damaging Het
Vps52 T C 17: 33,962,817 L539P probably damaging Het
Ythdc1 C A 5: 86,828,102 P529T possibly damaging Het
Zdhhc13 T C 7: 48,805,696 probably null Het
Zfp282 A T 6: 47,905,089 Y570F possibly damaging Het
Zfp872 A T 9: 22,200,111 K295N probably damaging Het
Other mutations in Casc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Casc1 APN 6 145175290 missense probably benign 0.00
IGL00586:Casc1 APN 6 145191576 missense possibly damaging 0.53
IGL01066:Casc1 APN 6 145176222 missense probably damaging 0.96
IGL01413:Casc1 APN 6 145175086 missense probably damaging 1.00
IGL02275:Casc1 APN 6 145177364 missense probably damaging 1.00
IGL02668:Casc1 APN 6 145205257 missense unknown
IGL03018:Casc1 APN 6 145183305 missense probably damaging 1.00
IGL03233:Casc1 APN 6 145181885 missense probably damaging 1.00
R0011:Casc1 UTSW 6 145179055 missense probably damaging 1.00
R0011:Casc1 UTSW 6 145179055 missense probably damaging 1.00
R0180:Casc1 UTSW 6 145183218 critical splice donor site probably benign
R0786:Casc1 UTSW 6 145181757 critical splice donor site probably null
R1916:Casc1 UTSW 6 145176200 missense probably benign 0.37
R2117:Casc1 UTSW 6 145205241 critical splice donor site probably null
R2174:Casc1 UTSW 6 145175170 missense probably damaging 1.00
R2264:Casc1 UTSW 6 145208429 utr 5 prime probably benign
R4393:Casc1 UTSW 6 145194578 missense possibly damaging 0.49
R4467:Casc1 UTSW 6 145183218 critical splice donor site probably null
R4847:Casc1 UTSW 6 145175185 missense probably damaging 1.00
R5014:Casc1 UTSW 6 145183266 missense probably damaging 1.00
R5207:Casc1 UTSW 6 145179068 missense probably damaging 1.00
R5264:Casc1 UTSW 6 145181776 missense probably benign 0.02
R5359:Casc1 UTSW 6 145196892 missense probably damaging 1.00
R5499:Casc1 UTSW 6 145177431 missense probably damaging 1.00
R6211:Casc1 UTSW 6 145200491 missense probably damaging 1.00
R6579:Casc1 UTSW 6 145179018 missense probably benign 0.19
R6939:Casc1 UTSW 6 145175219 missense possibly damaging 0.46
R7108:Casc1 UTSW 6 145185865 nonsense probably null
R7131:Casc1 UTSW 6 145177406 missense probably null 0.97
R7810:Casc1 UTSW 6 145194586 missense probably benign 0.28
R8017:Casc1 UTSW 6 145194557 missense probably damaging 1.00
R8680:Casc1 UTSW 6 145181816 missense probably benign 0.13
R8720:Casc1 UTSW 6 145205257 missense unknown
R9118:Casc1 UTSW 6 145175174 missense probably damaging 1.00
R9118:Casc1 UTSW 6 145175245 missense probably damaging 1.00
R9172:Casc1 UTSW 6 145177449 missense probably benign
R9290:Casc1 UTSW 6 145202962 missense unknown
X0063:Casc1 UTSW 6 145175271 missense probably benign 0.13
Z1176:Casc1 UTSW 6 145205293 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACACACGCTGTAAGGGCTAG -3'
(R):5'- TGAGAGACTTATCTGCAAGCTG -3'

Sequencing Primer
(F):5'- CGCTGTAAGGGCTAGGAATAGC -3'
(R):5'- GGTACCCAGCAGTTCCATC -3'
Posted On 2020-09-02