Incidental Mutation 'R8385:Olfr513'
ID 647122
Institutional Source Beutler Lab
Gene Symbol Olfr513
Ensembl Gene ENSMUSG00000051200
Gene Name olfactory receptor 513
Synonyms MOR195-1, GA_x6K02T2PBJ9-11084889-11085818
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock # R8385 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 108750973-108756800 bp(+) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to G at 108755304 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 149 (Y149*)
Ref Sequence ENSEMBL: ENSMUSP00000149440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055146] [ENSMUST00000214670]
AlphaFold Q8VFZ3
Predicted Effect probably null
Transcript: ENSMUST00000055146
AA Change: Y149*
SMART Domains Protein: ENSMUSP00000050578
Gene: ENSMUSG00000051200
AA Change: Y149*

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 2.7e-55 PFAM
Pfam:7TM_GPCR_Srsx 33 304 2.3e-6 PFAM
Pfam:7tm_1 39 289 2.8e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000214670
AA Change: Y149*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930572O03Rik A T 5: 15,652,671 S203T unknown Het
4933406M09Rik A G 1: 134,390,638 K383E probably benign Het
Brap C T 5: 121,685,134 T473I probably benign Het
Cacna1e T A 1: 154,443,941 M1400L probably damaging Het
Casc1 C T 6: 145,175,192 E685K probably damaging Het
Catsper2 A G 2: 121,410,140 I127T possibly damaging Het
Dbt A T 3: 116,523,390 I72F probably damaging Het
Ddhd2 T C 8: 25,735,014 H592R probably damaging Het
Disp2 T A 2: 118,790,410 M541K probably damaging Het
Dnmbp T C 19: 43,889,651 D327G probably benign Het
Dvl1 A G 4: 155,855,580 S390G possibly damaging Het
Fam205a1 C T 4: 42,850,509 R549H possibly damaging Het
Fbxo22 A G 9: 55,213,949 D106G probably damaging Het
Gfm2 A G 13: 97,165,011 T441A probably benign Het
Gm5431 T C 11: 48,889,520 I192V probably damaging Het
Gosr1 T A 11: 76,730,141 T241S possibly damaging Het
Hk2 T C 6: 82,729,546 S792G probably benign Het
Itsn1 A C 16: 91,893,811 K1302Q unknown Het
Kif16b T C 2: 142,712,338 K847E probably benign Het
Lfng G A 5: 140,613,226 E297K probably damaging Het
Mark3 A G 12: 111,655,374 D650G possibly damaging Het
Mob3b T C 4: 34,985,980 Y186C probably damaging Het
Mphosph9 T C 5: 124,312,722 K329E probably benign Het
Mta1 A T 12: 113,131,465 M448L probably benign Het
Mterf1a A T 5: 3,891,384 N161K probably damaging Het
Myo10 T A 15: 25,804,398 I1593N probably damaging Het
Naca A G 10: 128,042,438 N1113S unknown Het
Olfr1362 T C 13: 21,611,352 I206V probably benign Het
Pcdhga1 A T 18: 37,662,096 D51V probably damaging Het
Peg3 T C 7: 6,708,083 E1380G probably damaging Het
Pkd1 G A 17: 24,575,728 V2130M possibly damaging Het
Pla2g4c C T 7: 13,329,664 P19S probably benign Het
Popdc2 G A 16: 38,362,900 V82I probably benign Het
Ppfibp2 A G 7: 107,697,687 R203G probably benign Het
Rab19 T A 6: 39,383,958 N13K probably benign Het
Raet1d T A 10: 22,370,918 D48E probably benign Het
Rell1 T A 5: 63,930,518 K136* probably null Het
Slc38a4 A G 15: 96,999,512 I474T probably damaging Het
Slf1 T C 13: 77,105,990 M243V probably benign Het
Spg11 A T 2: 122,097,321 S661T probably benign Het
Thra C G 11: 98,768,351 S435R probably benign Het
Tmem181a T C 17: 6,288,999 I61T probably benign Het
Ttpa G A 4: 20,028,483 G247S probably damaging Het
Usp17lb C T 7: 104,840,623 V366I possibly damaging Het
Vit A T 17: 78,619,637 Q337L probably benign Het
Vmn2r102 A G 17: 19,693,826 Y551C possibly damaging Het
Vps52 T C 17: 33,962,817 L539P probably damaging Het
Ythdc1 C A 5: 86,828,102 P529T possibly damaging Het
Zdhhc13 T C 7: 48,805,696 probably null Het
Zfp282 A T 6: 47,905,089 Y570F possibly damaging Het
Zfp872 A T 9: 22,200,111 K295N probably damaging Het
Other mutations in Olfr513
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02491:Olfr513 APN 7 108755114 missense probably damaging 1.00
IGL03086:Olfr513 APN 7 108755796 utr 3 prime probably benign
FR4340:Olfr513 UTSW 7 108754954 small insertion probably benign
IGL02799:Olfr513 UTSW 7 108755623 missense probably benign
R0218:Olfr513 UTSW 7 108755574 nonsense probably null
R1103:Olfr513 UTSW 7 108754883 missense possibly damaging 0.92
R1251:Olfr513 UTSW 7 108754907 missense probably damaging 0.99
R1450:Olfr513 UTSW 7 108755512 missense probably damaging 1.00
R1582:Olfr513 UTSW 7 108755110 missense probably benign 0.04
R1608:Olfr513 UTSW 7 108755102 missense probably damaging 0.99
R1726:Olfr513 UTSW 7 108755008 missense probably benign 0.00
R1880:Olfr513 UTSW 7 108755128 missense probably damaging 1.00
R1881:Olfr513 UTSW 7 108755128 missense probably damaging 1.00
R2136:Olfr513 UTSW 7 108755223 missense possibly damaging 0.58
R2216:Olfr513 UTSW 7 108755612 missense probably damaging 1.00
R4006:Olfr513 UTSW 7 108755261 missense probably damaging 1.00
R4603:Olfr513 UTSW 7 108755627 missense probably damaging 1.00
R4881:Olfr513 UTSW 7 108755405 missense probably damaging 1.00
R5132:Olfr513 UTSW 7 108755270 missense probably damaging 1.00
R5426:Olfr513 UTSW 7 108755717 missense possibly damaging 0.94
R5679:Olfr513 UTSW 7 108754996 missense probably damaging 0.97
R5848:Olfr513 UTSW 7 108755574 nonsense probably null
R5911:Olfr513 UTSW 7 108755675 missense probably benign 0.36
R6474:Olfr513 UTSW 7 108755029 missense probably damaging 1.00
R7016:Olfr513 UTSW 7 108755711 missense probably damaging 1.00
R7783:Olfr513 UTSW 7 108755569 missense probably damaging 1.00
R8113:Olfr513 UTSW 7 108755231 missense probably damaging 1.00
R9429:Olfr513 UTSW 7 108755205 missense probably damaging 0.98
Z1088:Olfr513 UTSW 7 108755104 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AAACCATCTCCTTTTCAGGCTG -3'
(R):5'- ATGCTTTACACTTGCCCTGGG -3'

Sequencing Primer
(F):5'- GTTTTGCTCAGCTGTACTTCTCCAG -3'
(R):5'- TCATGAGGGATCCAGTGAGATTC -3'
Posted On 2020-09-02