Incidental Mutation 'R8386:Zfp882'
ID 647162
Institutional Source Beutler Lab
Gene Symbol Zfp882
Ensembl Gene ENSMUSG00000089857
Gene Name zinc finger protein 882
Synonyms ENSMUSG00000052439
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock # R8386 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 71908608-71916354 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71914118 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 263 (H263R)
Ref Sequence ENSEMBL: ENSMUSP00000105629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110002] [ENSMUST00000125802] [ENSMUST00000126607] [ENSMUST00000131544]
AlphaFold E9Q4R4
Predicted Effect probably benign
Transcript: ENSMUST00000110002
AA Change: H263R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105629
Gene: ENSMUSG00000089857
AA Change: H263R

DomainStartEndE-ValueType
KRAB 4 61 8.58e-14 SMART
ZnF_C2H2 84 106 1.47e-3 SMART
ZnF_C2H2 168 190 8.47e-4 SMART
ZnF_C2H2 196 218 2.27e-4 SMART
ZnF_C2H2 224 246 6.31e1 SMART
ZnF_C2H2 251 273 1.16e-1 SMART
ZnF_C2H2 279 301 1.25e-1 SMART
ZnF_C2H2 307 329 5.42e-2 SMART
ZnF_C2H2 335 357 1.47e-3 SMART
ZnF_C2H2 363 385 7.26e-3 SMART
ZnF_C2H2 391 413 1.26e-2 SMART
ZnF_C2H2 419 441 3.29e1 SMART
ZnF_C2H2 447 469 2.67e-1 SMART
ZnF_C2H2 475 497 1.04e-3 SMART
ZnF_C2H2 503 525 4.11e-2 SMART
ZnF_C2H2 531 553 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125802
SMART Domains Protein: ENSMUSP00000121316
Gene: ENSMUSG00000089857

DomainStartEndE-ValueType
KRAB 12 69 8.58e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126607
SMART Domains Protein: ENSMUSP00000119978
Gene: ENSMUSG00000089857

DomainStartEndE-ValueType
KRAB 44 101 8.58e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131544
SMART Domains Protein: ENSMUSP00000120213
Gene: ENSMUSG00000066880

DomainStartEndE-ValueType
KRAB 4 56 1.08e-10 SMART
ZnF_C2H2 167 189 8.47e-4 SMART
ZnF_C2H2 195 217 8.34e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik C T 15: 81,980,629 L24F probably damaging Het
Abca9 G T 11: 110,130,692 A1064D probably damaging Het
Adgb A G 10: 10,350,304 I1390T probably damaging Het
Aktip G A 8: 91,131,046 R13C probably benign Het
Arnt2 T A 7: 84,347,539 I71F probably damaging Het
Casr T A 16: 36,515,588 I120F probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cntnap1 A T 11: 101,182,203 R544S probably damaging Het
Cse1l T C 2: 166,919,684 S53P probably benign Het
Cyfip1 T C 7: 55,877,740 S207P probably damaging Het
Fam120b G A 17: 15,422,984 S675N probably benign Het
Fcna C T 2: 25,626,015 W163* probably null Het
Gast A G 11: 100,336,865 D91G probably damaging Het
Igkv6-14 T C 6: 70,434,982 Y106C probably damaging Het
Lin28b A G 10: 45,469,044 V62A probably damaging Het
Malrd1 T A 2: 15,696,844 S757T unknown Het
Ms4a15 A T 19: 10,993,182 C3S unknown Het
Muc5ac G A 7: 141,807,634 V1561I possibly damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr495 TTTCTTCTTCT TTTCTTCT 7: 108,395,348 probably benign Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Ppp1r3c T C 19: 36,733,938 D144G probably damaging Het
Setd1b T A 5: 123,144,256 V149D unknown Het
Shcbp1 A C 8: 4,767,951 W115G probably damaging Het
Shroom1 A T 11: 53,466,403 K631M probably damaging Het
Sipa1l2 A T 8: 125,492,093 S168R probably damaging Het
Slc12a4 A T 8: 105,951,618 N314K probably damaging Het
Syngap1 T A 17: 26,960,491 M755K possibly damaging Het
Tnik A G 3: 28,263,674 D11G unknown Het
Trim80 A G 11: 115,445,074 D274G probably damaging Het
Ush2a A G 1: 188,728,206 T2555A possibly damaging Het
Vps13a A T 19: 16,701,119 probably null Het
Wnt7a C T 6: 91,366,288 G204D probably damaging Het
Zfp420 A T 7: 29,875,618 Y421F probably benign Het
Other mutations in Zfp882
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Zfp882 APN 8 71913827 missense probably benign
R0244:Zfp882 UTSW 8 71913523 missense possibly damaging 0.79
R0270:Zfp882 UTSW 8 71914615 missense probably benign 0.05
R0636:Zfp882 UTSW 8 71914337 missense probably benign 0.01
R0840:Zfp882 UTSW 8 71914686 nonsense probably null
R1299:Zfp882 UTSW 8 71913473 missense probably damaging 1.00
R4439:Zfp882 UTSW 8 71913609 missense probably damaging 0.97
R4829:Zfp882 UTSW 8 71914389 missense probably damaging 1.00
R5028:Zfp882 UTSW 8 71914654 missense possibly damaging 0.70
R5296:Zfp882 UTSW 8 71914360 missense probably damaging 1.00
R5882:Zfp882 UTSW 8 71913459 critical splice acceptor site probably null
R5974:Zfp882 UTSW 8 71913155 missense probably damaging 1.00
R6052:Zfp882 UTSW 8 71914505 missense probably benign 0.01
R6383:Zfp882 UTSW 8 71914640 missense probably damaging 1.00
R6888:Zfp882 UTSW 8 71914286 missense probably benign 0.01
R6987:Zfp882 UTSW 8 71914673 missense probably benign 0.01
R7045:Zfp882 UTSW 8 71913249 critical splice donor site probably null
R7780:Zfp882 UTSW 8 71914229 missense possibly damaging 0.89
R7793:Zfp882 UTSW 8 71913141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTTGCTGGTATTCAACAGCAC -3'
(R):5'- CCCTGTGAATCTGTTCATGGTATC -3'

Sequencing Primer
(F):5'- GGCAAAACCTTCACTTATTCCAGTGG -3'
(R):5'- GTGATGCATGAAGGCTTTCCCAC -3'
Posted On 2020-09-02