Incidental Mutation 'R8386:1700029P11Rik'
ID647174
Institutional Source Beutler Lab
Gene Symbol 1700029P11Rik
Ensembl Gene ENSMUSG00000061633
Gene NameRIKEN cDNA 1700029P11 gene
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R8386 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location81980540-81981563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 81980629 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 24 (L24F)
Ref Sequence ENSEMBL: ENSMUSP00000074190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074608]
Predicted Effect probably damaging
Transcript: ENSMUST00000074608
AA Change: L24F

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074190
Gene: ENSMUSG00000061633
AA Change: L24F

DomainStartEndE-ValueType
Pfam:ESSS 19 130 6.9e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 G T 11: 110,130,692 A1064D probably damaging Het
Adgb A G 10: 10,350,304 I1390T probably damaging Het
Aktip G A 8: 91,131,046 R13C probably benign Het
Arnt2 T A 7: 84,347,539 I71F probably damaging Het
Casr T A 16: 36,515,588 I120F probably damaging Het
Cilp G A 9: 65,279,004 G794S probably damaging Het
Cntnap1 A T 11: 101,182,203 R544S probably damaging Het
Cse1l T C 2: 166,919,684 S53P probably benign Het
Cyfip1 T C 7: 55,877,740 S207P probably damaging Het
Fam120b G A 17: 15,422,984 S675N probably benign Het
Fcna C T 2: 25,626,015 W163* probably null Het
Gast A G 11: 100,336,865 D91G probably damaging Het
Igkv6-14 T C 6: 70,434,982 Y106C probably damaging Het
Lin28b A G 10: 45,469,044 V62A probably damaging Het
Malrd1 T A 2: 15,696,844 S757T unknown Het
Ms4a15 A T 19: 10,993,182 C3S unknown Het
Muc5ac G A 7: 141,807,634 V1561I possibly damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr495 TTTCTTCTTCT TTTCTTCT 7: 108,395,348 probably benign Het
Pi16 C A 17: 29,319,234 P7Q possibly damaging Het
Ppp1r3c T C 19: 36,733,938 D144G probably damaging Het
Setd1b T A 5: 123,144,256 V149D unknown Het
Shcbp1 A C 8: 4,767,951 W115G probably damaging Het
Shroom1 A T 11: 53,466,403 K631M probably damaging Het
Sipa1l2 A T 8: 125,492,093 S168R probably damaging Het
Slc12a4 A T 8: 105,951,618 N314K probably damaging Het
Syngap1 T A 17: 26,960,491 M755K possibly damaging Het
Tnik A G 3: 28,263,674 D11G unknown Het
Trim80 A G 11: 115,445,074 D274G probably damaging Het
Ush2a A G 1: 188,728,206 T2555A possibly damaging Het
Vps13a A T 19: 16,701,119 probably null Het
Wnt7a C T 6: 91,366,288 G204D probably damaging Het
Zfp420 A T 7: 29,875,618 Y421F probably benign Het
Zfp882 A G 8: 71,914,118 H263R probably benign Het
Other mutations in 1700029P11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1836:1700029P11Rik UTSW 15 81980867 missense probably damaging 0.97
R5581:1700029P11Rik UTSW 15 81980836 missense probably damaging 1.00
R5888:1700029P11Rik UTSW 15 81980671 missense probably benign 0.03
R6556:1700029P11Rik UTSW 15 81980738 missense probably damaging 0.99
R8317:1700029P11Rik UTSW 15 81980777 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCGGAGGATGTCAGTGC -3'
(R):5'- GCGTGCATATTCAAGGCATC -3'

Sequencing Primer
(F):5'- GTTAAGGGAAGCTATTCTCCACAC -3'
(R):5'- AGGCATCCACCTTCGGG -3'
Posted On2020-09-02