Incidental Mutation 'R8387:Flvcr1'
ID647185
Institutional Source Beutler Lab
Gene Symbol Flvcr1
Ensembl Gene ENSMUSG00000066595
Gene Namefeline leukemia virus subgroup C cellular receptor 1
SynonymsMfsd7b, 9630055N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8387 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location191005847-191026158 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 191011534 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000082777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085635] [ENSMUST00000085635] [ENSMUST00000085635] [ENSMUST00000192666]
Predicted Effect probably null
Transcript: ENSMUST00000085635
SMART Domains Protein: ENSMUSP00000082777
Gene: ENSMUSG00000066595

DomainStartEndE-ValueType
low complexity region 40 68 N/A INTRINSIC
Pfam:MFS_1 100 483 1.5e-28 PFAM
transmembrane domain 498 517 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000085635
SMART Domains Protein: ENSMUSP00000082777
Gene: ENSMUSG00000066595

DomainStartEndE-ValueType
low complexity region 40 68 N/A INTRINSIC
Pfam:MFS_1 100 483 1.5e-28 PFAM
transmembrane domain 498 517 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000085635
SMART Domains Protein: ENSMUSP00000082777
Gene: ENSMUSG00000066595

DomainStartEndE-ValueType
low complexity region 40 68 N/A INTRINSIC
Pfam:MFS_1 100 483 1.5e-28 PFAM
transmembrane domain 498 517 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192666
SMART Domains Protein: ENSMUSP00000141985
Gene: ENSMUSG00000066595

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
Pfam:MFS_1 54 198 3.1e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the major facilitator superfamily of transporter proteins. The encoded protein is a heme transporter that may play a critical role in erythropoiesis by protecting developing erythroid cells from heme toxicity. This gene may play a role in posterior column ataxia with retinitis pigmentosa and the hematological disorder Diamond-Blackfan syndrome. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit runting, cardiomegaly and splenomegaly, lack definitive erythropoiesis, develop severe hyperchromic macrocytic anemia and reticulocytopenia, and show craniofacial and limb defects and intrauterine lethality modulated by genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Arl14ep T C 2: 106,969,217 D93G probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpa3 T C 3: 20,227,236 I169V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dab2ip T A 2: 35,719,858 I695K probably damaging Het
Dhtkd1 C A 2: 5,929,668 L230F possibly damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Mapk8ip2 T C 15: 89,460,694 F765L probably damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Nr4a1 T C 15: 101,273,172 S510P probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1218 T C 2: 89,055,302 I41M probably benign Het
Olfr1394 T C 11: 49,160,670 S219P probably damaging Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pias4 G A 10: 81,154,508 R398C probably benign Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Ptprr A G 10: 116,251,125 Y503C probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Tox3 A G 8: 90,257,967 S195P probably benign Het
Trim44 T C 2: 102,400,173 E171G probably damaging Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Vmn2r77 C A 7: 86,801,739 Q278K probably benign Het
Zfp345 T C 2: 150,472,820 T266A probably damaging Het
Other mutations in Flvcr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Flvcr1 APN 1 191015489 nonsense probably null
IGL01089:Flvcr1 APN 1 191013390 missense probably damaging 0.98
IGL02572:Flvcr1 APN 1 191025646 missense probably damaging 1.00
IGL03248:Flvcr1 APN 1 191025742 missense probably damaging 1.00
R0009:Flvcr1 UTSW 1 191008191 missense probably benign
R0122:Flvcr1 UTSW 1 191021226 missense possibly damaging 0.79
R0363:Flvcr1 UTSW 1 191012254 splice site probably benign
R0417:Flvcr1 UTSW 1 191011219 missense probably benign 0.05
R0718:Flvcr1 UTSW 1 191025582 missense probably damaging 1.00
R1061:Flvcr1 UTSW 1 191008173 missense probably benign 0.01
R1815:Flvcr1 UTSW 1 191025380 missense probably damaging 1.00
R2029:Flvcr1 UTSW 1 191021156 missense probably benign 0.01
R4590:Flvcr1 UTSW 1 191012146 missense probably benign 0.05
R4766:Flvcr1 UTSW 1 191021106 missense probably benign 0.00
R4889:Flvcr1 UTSW 1 191025567 missense probably damaging 1.00
R4976:Flvcr1 UTSW 1 191025495 missense probably damaging 1.00
R5434:Flvcr1 UTSW 1 191026009 missense probably benign 0.07
R5508:Flvcr1 UTSW 1 191025459 missense probably damaging 1.00
R5930:Flvcr1 UTSW 1 191009551 missense probably damaging 1.00
R6698:Flvcr1 UTSW 1 191025732 missense probably damaging 1.00
R6927:Flvcr1 UTSW 1 191025664 missense possibly damaging 0.66
R7544:Flvcr1 UTSW 1 191025946 missense probably damaging 0.99
R7654:Flvcr1 UTSW 1 191011605 missense possibly damaging 0.83
R7853:Flvcr1 UTSW 1 191025646 missense probably damaging 1.00
X0064:Flvcr1 UTSW 1 191025447 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CACAAGACAGGCGGCATATG -3'
(R):5'- AGCTAGCTGCATTATTCTCTGC -3'

Sequencing Primer
(F):5'- TGTACAGGCAAGCTCATCTG -3'
(R):5'- GCATTATTCTCTGCAGAGGGACC -3'
Posted On2020-09-02