Incidental Mutation 'R8387:Dhtkd1'
ID647186
Institutional Source Beutler Lab
Gene Symbol Dhtkd1
Ensembl Gene ENSMUSG00000025815
Gene Namedehydrogenase E1 and transketolase domain containing 1
SynonymsC330018I04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8387 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location5896115-5942792 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 5929668 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 230 (L230F)
Ref Sequence ENSEMBL: ENSMUSP00000026924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026924] [ENSMUST00000095147]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026924
AA Change: L230F

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026924
Gene: ENSMUSG00000025815
AA Change: L230F

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 150 165 N/A INTRINSIC
Pfam:E1_dh 193 505 2.4e-44 PFAM
Blast:Transket_pyr 523 558 9e-8 BLAST
Transket_pyr 570 773 2.1e-54 SMART
Blast:Transket_pyr 775 805 7e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000095147
AA Change: L230F

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000092769
Gene: ENSMUSG00000025815
AA Change: L230F

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 150 165 N/A INTRINSIC
Pfam:E1_dh 193 505 2.4e-44 PFAM
Blast:Transket_pyr 523 558 9e-8 BLAST
Transket_pyr 570 773 2.1e-54 SMART
Blast:Transket_pyr 775 805 7e-8 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of a mitochondrial 2-oxoglutarate-dehydrogenase-complex-like protein involved in the degradation pathways of several amino acids, including lysine. Mutations in this gene are associated with 2-aminoadipic 2-oxoadipic aciduria and Charcot-Marie-Tooth Disease Type 2Q. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Arl14ep T C 2: 106,969,217 D93G probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpa3 T C 3: 20,227,236 I169V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dab2ip T A 2: 35,719,858 I695K probably damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Flvcr1 A G 1: 191,011,534 probably null Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Mapk8ip2 T C 15: 89,460,694 F765L probably damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Nr4a1 T C 15: 101,273,172 S510P probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1218 T C 2: 89,055,302 I41M probably benign Het
Olfr1394 T C 11: 49,160,670 S219P probably damaging Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pias4 G A 10: 81,154,508 R398C probably benign Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Ptprr A G 10: 116,251,125 Y503C probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Tox3 A G 8: 90,257,967 S195P probably benign Het
Trim44 T C 2: 102,400,173 E171G probably damaging Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Vmn2r77 C A 7: 86,801,739 Q278K probably benign Het
Zfp345 T C 2: 150,472,820 T266A probably damaging Het
Other mutations in Dhtkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Dhtkd1 APN 2 5929657 missense probably damaging 1.00
IGL01544:Dhtkd1 APN 2 5913531 missense probably benign 0.00
IGL01724:Dhtkd1 APN 2 5914840 missense probably benign 0.00
IGL01726:Dhtkd1 APN 2 5942656 missense unknown
IGL02069:Dhtkd1 APN 2 5930934 nonsense probably null 0.00
IGL02476:Dhtkd1 APN 2 5930906 missense possibly damaging 0.89
IGL02662:Dhtkd1 APN 2 5899972 missense probably damaging 1.00
IGL02937:Dhtkd1 APN 2 5917905 missense possibly damaging 0.49
PIT4486001:Dhtkd1 UTSW 2 5899995 missense probably benign
R0277:Dhtkd1 UTSW 2 5914888 missense probably benign 0.00
R0323:Dhtkd1 UTSW 2 5914888 missense probably benign 0.00
R0373:Dhtkd1 UTSW 2 5911870 missense probably damaging 1.00
R0512:Dhtkd1 UTSW 2 5904091 missense probably damaging 1.00
R1497:Dhtkd1 UTSW 2 5904113 missense probably damaging 1.00
R1924:Dhtkd1 UTSW 2 5911933 missense probably damaging 1.00
R1943:Dhtkd1 UTSW 2 5932482 missense probably benign 0.11
R1976:Dhtkd1 UTSW 2 5902391 missense possibly damaging 0.95
R2057:Dhtkd1 UTSW 2 5942619 missense unknown
R5050:Dhtkd1 UTSW 2 5917689 missense probably benign 0.00
R5057:Dhtkd1 UTSW 2 5919513 missense probably damaging 1.00
R5133:Dhtkd1 UTSW 2 5904002 missense probably damaging 1.00
R5219:Dhtkd1 UTSW 2 5914816 missense probably benign 0.01
R5437:Dhtkd1 UTSW 2 5924119 missense probably benign 0.01
R5526:Dhtkd1 UTSW 2 5911851 missense probably damaging 1.00
R5720:Dhtkd1 UTSW 2 5903014 missense probably damaging 1.00
R6006:Dhtkd1 UTSW 2 5904025 nonsense probably null
R6155:Dhtkd1 UTSW 2 5910359 missense probably null 1.00
R6675:Dhtkd1 UTSW 2 5904078 missense probably damaging 1.00
R6870:Dhtkd1 UTSW 2 5919437 splice site probably null
R6899:Dhtkd1 UTSW 2 5917965 missense possibly damaging 0.91
R7123:Dhtkd1 UTSW 2 5917780 missense probably damaging 0.99
R7131:Dhtkd1 UTSW 2 5904070 missense probably benign 0.23
R7366:Dhtkd1 UTSW 2 5917906 missense probably benign 0.01
R7568:Dhtkd1 UTSW 2 5922087 splice site probably null
R7731:Dhtkd1 UTSW 2 5924112 missense probably benign 0.07
R7874:Dhtkd1 UTSW 2 5917674 missense possibly damaging 0.72
R8081:Dhtkd1 UTSW 2 5924108 missense probably damaging 1.00
R8340:Dhtkd1 UTSW 2 5919597 missense probably damaging 0.98
R8378:Dhtkd1 UTSW 2 5917888 missense probably benign
Z1088:Dhtkd1 UTSW 2 5911874 missense possibly damaging 0.84
Z1177:Dhtkd1 UTSW 2 5942628 missense unknown
Predicted Primers PCR Primer
(F):5'- GGAACTTAGCACCATCACCTTC -3'
(R):5'- ACTTGACTGTCTTCCGGCAG -3'

Sequencing Primer
(F):5'- TGGAGTCTCATCAACATGGC -3'
(R):5'- GGCAGCTCATATGTCTGTTCCATAG -3'
Posted On2020-09-02