Incidental Mutation 'R8387:Olfr1218'
ID647189
Institutional Source Beutler Lab
Gene Symbol Olfr1218
Ensembl Gene ENSMUSG00000075105
Gene Nameolfactory receptor 1218
SynonymsGA_x6K02T2Q125-50536041-50535106, MOR233-12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8387 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location89052296-89061187 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89055302 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 41 (I41M)
Ref Sequence ENSEMBL: ENSMUSP00000149558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099798] [ENSMUST00000213609] [ENSMUST00000215048] [ENSMUST00000215054]
Predicted Effect probably benign
Transcript: ENSMUST00000099798
AA Change: I41M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097386
Gene: ENSMUSG00000075105
AA Change: I41M

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 1.4e-45 PFAM
Pfam:7tm_1 39 286 2.2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213609
AA Change: I41M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215048
AA Change: I41M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215054
AA Change: I41M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Arl14ep T C 2: 106,969,217 D93G probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpa3 T C 3: 20,227,236 I169V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dab2ip T A 2: 35,719,858 I695K probably damaging Het
Dhtkd1 C A 2: 5,929,668 L230F possibly damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Flvcr1 A G 1: 191,011,534 probably null Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Mapk8ip2 T C 15: 89,460,694 F765L probably damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Nr4a1 T C 15: 101,273,172 S510P probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1394 T C 11: 49,160,670 S219P probably damaging Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pias4 G A 10: 81,154,508 R398C probably benign Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Ptprr A G 10: 116,251,125 Y503C probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Tox3 A G 8: 90,257,967 S195P probably benign Het
Trim44 T C 2: 102,400,173 E171G probably damaging Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Vmn2r77 C A 7: 86,801,739 Q278K probably benign Het
Zfp345 T C 2: 150,472,820 T266A probably damaging Het
Other mutations in Olfr1218
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Olfr1218 APN 2 89054569 missense probably damaging 1.00
IGL03089:Olfr1218 APN 2 89055013 missense probably benign 0.34
IGL03387:Olfr1218 APN 2 89055113 missense probably damaging 1.00
R0350:Olfr1218 UTSW 2 89055356 missense probably benign 0.10
R0699:Olfr1218 UTSW 2 89055292 missense possibly damaging 0.67
R1609:Olfr1218 UTSW 2 89055344 missense probably benign
R1856:Olfr1218 UTSW 2 89054859 missense possibly damaging 0.95
R1972:Olfr1218 UTSW 2 89054547 missense probably benign 0.05
R2066:Olfr1218 UTSW 2 89054899 missense probably damaging 0.99
R2921:Olfr1218 UTSW 2 89054499 missense probably benign 0.04
R2923:Olfr1218 UTSW 2 89054499 missense probably benign 0.04
R4037:Olfr1218 UTSW 2 89054688 missense probably damaging 0.99
R4585:Olfr1218 UTSW 2 89055154 missense possibly damaging 0.77
R4586:Olfr1218 UTSW 2 89055154 missense possibly damaging 0.77
R5041:Olfr1218 UTSW 2 89054921 nonsense probably null
R5124:Olfr1218 UTSW 2 89055087 missense probably damaging 0.96
R5138:Olfr1218 UTSW 2 89054947 missense probably benign 0.00
R5415:Olfr1218 UTSW 2 89054896 missense probably benign 0.00
R5501:Olfr1218 UTSW 2 89054886 nonsense probably null
R5941:Olfr1218 UTSW 2 89054619 missense probably benign
R5991:Olfr1218 UTSW 2 89054782 missense probably benign 0.01
R6396:Olfr1218 UTSW 2 89055297 missense probably benign 0.36
R7047:Olfr1218 UTSW 2 89055146 missense probably damaging 0.98
R8038:Olfr1218 UTSW 2 89054868 missense probably damaging 1.00
R8403:Olfr1218 UTSW 2 89054604 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATGCAACAGCCAAAGGAG -3'
(R):5'- ATTCAAGAGCGTTGTACCCC -3'

Sequencing Primer
(F):5'- CAGCCAAAGGAGATGGTCTTC -3'
(R):5'- AATAGACTCCTCAATGCAAA -3'
Posted On2020-09-02