Incidental Mutation 'R0019:Trim69'
List |< first << previous [record 50 of 59] next >> last >|
ID64719
Institutional Source Beutler Lab
Gene Symbol Trim69
Ensembl Gene ENSMUSG00000033368
Gene Nametripartite motif-containing 69
Synonyms4921519C19Rik, Rnf36, Trif
MMRRC Submission 038314-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0019 (G1)
Quality Score153
Status Validated
Chromosome2
Chromosomal Location122160700-122179027 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to T at 122174477 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028665] [ENSMUST00000036089]
Predicted Effect probably benign
Transcript: ENSMUST00000028665
SMART Domains Protein: ENSMUSP00000028665
Gene: ENSMUSG00000027233

DomainStartEndE-ValueType
low complexity region 33 41 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:PAT1 247 490 6.7e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000036089
SMART Domains Protein: ENSMUSP00000047627
Gene: ENSMUSG00000033368

DomainStartEndE-ValueType
RING 42 82 8.48e-8 SMART
low complexity region 95 111 N/A INTRINSIC
PDB:4NQJ|C 144 322 2e-86 PDB
PRY 323 375 9.37e-19 SMART
SPRY 376 500 4.97e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143088
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING-B-box-coiled-coil (RBCC) family and encodes a protein with an N-terminal RING finger motif, a PRY domain and a C-terminal SPRY domain. The mouse ortholog of this gene is specifically expressed in germ cells at the round spermatid stages during spermatogenesis and, when overexpressed, induces apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl1 T A 8: 46,521,250 probably null Het
Ankrd13a T A 5: 114,786,081 probably benign Het
D130043K22Rik T A 13: 24,880,812 V737D probably damaging Het
Dhx37 C A 5: 125,430,034 G133C probably benign Het
Espl1 A C 15: 102,306,319 Q765P probably null Het
Fasn A T 11: 120,807,998 probably benign Het
Fshb T C 2: 107,057,345 S110G probably benign Het
Gm14025 G T 2: 129,039,026 H327N probably benign Het
Gsap T C 5: 21,270,622 probably benign Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Herc3 T C 6: 58,885,065 probably benign Het
Il1r2 C T 1: 40,125,050 T359M probably damaging Het
Lrig1 T A 6: 94,607,349 R905* probably null Het
Myh7 T A 14: 54,983,734 N911Y possibly damaging Het
Nfatc1 C A 18: 80,635,504 V890L probably benign Het
Pcolce2 A G 9: 95,694,964 probably null Het
Pdcl A T 2: 37,351,920 L273M probably damaging Het
Pycrl A G 15: 75,919,306 probably benign Het
Rlf A G 4: 121,146,572 V1737A possibly damaging Het
Sstr1 T C 12: 58,213,149 L186S probably damaging Het
Trim80 T G 11: 115,447,942 Y533D probably damaging Het
Unc13b T C 4: 43,096,990 I121T possibly damaging Het
Ywhab T A 2: 164,016,170 I219N probably damaging Het
Zfp560 G A 9: 20,348,360 S402L probably benign Het
Zfp943 C T 17: 21,992,089 probably benign Het
Other mutations in Trim69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Trim69 APN 2 122167714 missense probably benign 0.00
IGL01321:Trim69 APN 2 122173284 missense possibly damaging 0.84
IGL01478:Trim69 APN 2 122178443 missense probably damaging 0.98
IGL01907:Trim69 APN 2 122167661 missense probably benign 0.00
IGL01925:Trim69 APN 2 122167916 missense probably damaging 1.00
IGL03065:Trim69 APN 2 122178634 missense probably damaging 0.98
IGL03121:Trim69 APN 2 122167647 missense probably benign 0.22
IGL03206:Trim69 APN 2 122173155 missense probably benign 0.00
R0019:Trim69 UTSW 2 122174477 splice site probably null
R1956:Trim69 UTSW 2 122174475 critical splice donor site probably null
R1960:Trim69 UTSW 2 122167684 missense probably benign 0.00
R2212:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3412:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3414:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3900:Trim69 UTSW 2 122178841 missense probably benign 0.03
R4470:Trim69 UTSW 2 122178599 missense probably damaging 1.00
R4950:Trim69 UTSW 2 122178746 missense probably damaging 1.00
R5045:Trim69 UTSW 2 122174246 missense probably benign 0.08
R5237:Trim69 UTSW 2 122173340 missense probably benign
R5931:Trim69 UTSW 2 122178594 missense probably damaging 0.98
R6483:Trim69 UTSW 2 122167600 nonsense probably null
R6872:Trim69 UTSW 2 122167910 missense probably damaging 1.00
R7372:Trim69 UTSW 2 122178583 missense possibly damaging 0.94
R7451:Trim69 UTSW 2 122168027 missense probably benign 0.19
R7591:Trim69 UTSW 2 122167973 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGGCAAGTGTTTCTTCATGGTTCTCTC -3'
(R):5'- TCCTGTTCAGTCCTCTGATATCTGCAAG -3'

Sequencing Primer
(F):5'- CTTCTTCTACCCCTGGAGAATG -3'
(R):5'- AAAATTGTGGCTAGTTCCACAC -3'
Posted On2013-08-06