Incidental Mutation 'R8387:Trim44'
ID647190
Institutional Source Beutler Lab
Gene Symbol Trim44
Ensembl Gene ENSMUSG00000027189
Gene Nametripartite motif-containing 44
SynonymsMc7, DIPB
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R8387 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location102300119-102407828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102400173 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 171 (E171G)
Ref Sequence ENSEMBL: ENSMUSP00000099633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102573] [ENSMUST00000144110]
Predicted Effect probably damaging
Transcript: ENSMUST00000102573
AA Change: E171G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099633
Gene: ENSMUSG00000027189
AA Change: E171G

DomainStartEndE-ValueType
Blast:BBOX 13 57 2e-11 BLAST
coiled coil region 125 153 N/A INTRINSIC
BBOX 175 216 1.48e-7 SMART
coiled coil region 295 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144110
SMART Domains Protein: ENSMUSP00000119847
Gene: ENSMUSG00000027189

DomainStartEndE-ValueType
coiled coil region 61 87 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000116958
Gene: ENSMUSG00000027189
AA Change: E28G

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
BBOX 33 74 1.48e-7 SMART
coiled coil region 126 157 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, namely a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Arl14ep T C 2: 106,969,217 D93G probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpa3 T C 3: 20,227,236 I169V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dab2ip T A 2: 35,719,858 I695K probably damaging Het
Dhtkd1 C A 2: 5,929,668 L230F possibly damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Flvcr1 A G 1: 191,011,534 probably null Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Mapk8ip2 T C 15: 89,460,694 F765L probably damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Nr4a1 T C 15: 101,273,172 S510P probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1218 T C 2: 89,055,302 I41M probably benign Het
Olfr1394 T C 11: 49,160,670 S219P probably damaging Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pias4 G A 10: 81,154,508 R398C probably benign Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Ptprr A G 10: 116,251,125 Y503C probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Tox3 A G 8: 90,257,967 S195P probably benign Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Vmn2r77 C A 7: 86,801,739 Q278K probably benign Het
Zfp345 T C 2: 150,472,820 T266A probably damaging Het
Other mutations in Trim44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00555:Trim44 APN 2 102304479 makesense probably null
IGL01328:Trim44 APN 2 102400020 missense probably benign 0.34
IGL01925:Trim44 APN 2 102400017 missense probably benign 0.30
IGL02033:Trim44 APN 2 102400176 missense possibly damaging 0.56
IGL02138:Trim44 APN 2 102380908 missense probably benign 0.31
IGL02824:Trim44 APN 2 102400195 missense possibly damaging 0.85
R0760:Trim44 UTSW 2 102400560 unclassified probably benign
R1695:Trim44 UTSW 2 102357485 missense possibly damaging 0.93
R2008:Trim44 UTSW 2 102400377 unclassified probably benign
R5366:Trim44 UTSW 2 102400131 missense probably damaging 0.97
R7253:Trim44 UTSW 2 102346968 missense possibly damaging 0.79
R7812:Trim44 UTSW 2 102400144 missense possibly damaging 0.72
R8129:Trim44 UTSW 2 102400503 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCCCGATACTCACTCTCAG -3'
(R):5'- ATCGCCAGAAGTTCCTCAGC -3'

Sequencing Primer
(F):5'- GATACTCACTCTCAGTTCTTCGAAGG -3'
(R):5'- TGGCTGCCTACGTCCATG -3'
Posted On2020-09-02