Incidental Mutation 'R8387:Arl14ep'
ID647191
Institutional Source Beutler Lab
Gene Symbol Arl14ep
Ensembl Gene ENSMUSG00000027122
Gene NameADP-ribosylation factor-like 14 effector protein
Synonyms4930448O08Rik, 2700007P21Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.263) question?
Stock #R8387 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location106962527-106974424 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106969217 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 93 (D93G)
Ref Sequence ENSEMBL: ENSMUSP00000028536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028536] [ENSMUST00000093883]
Predicted Effect probably damaging
Transcript: ENSMUST00000028536
AA Change: D93G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028536
Gene: ENSMUSG00000027122
AA Change: D93G

DomainStartEndE-ValueType
low complexity region 125 132 N/A INTRINSIC
Pfam:ARF7EP_C 143 249 4.9e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000093883
AA Change: D93G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091409
Gene: ENSMUSG00000027122
AA Change: D93G

DomainStartEndE-ValueType
low complexity region 125 132 N/A INTRINSIC
Pfam:ARF7EP_C 145 248 1.1e-39 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an effector protein. It interacts with ADP-ribosylation factor-like 14 [ARL14, also known as ADP-ribosylation factor 7 (ARF7)], beta-actin (ACTB) and actin-based motor protein myosin 1E (MYO1E). ARL14 is a small GTPase; it controls the export of major histocompatibility class II molecules by connecting to the actin network via this effector protein. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpa3 T C 3: 20,227,236 I169V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dab2ip T A 2: 35,719,858 I695K probably damaging Het
Dhtkd1 C A 2: 5,929,668 L230F possibly damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Flvcr1 A G 1: 191,011,534 probably null Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Mapk8ip2 T C 15: 89,460,694 F765L probably damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Nr4a1 T C 15: 101,273,172 S510P probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1218 T C 2: 89,055,302 I41M probably benign Het
Olfr1394 T C 11: 49,160,670 S219P probably damaging Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pias4 G A 10: 81,154,508 R398C probably benign Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Ptprr A G 10: 116,251,125 Y503C probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Tox3 A G 8: 90,257,967 S195P probably benign Het
Trim44 T C 2: 102,400,173 E171G probably damaging Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Vmn2r77 C A 7: 86,801,739 Q278K probably benign Het
Zfp345 T C 2: 150,472,820 T266A probably damaging Het
Other mutations in Arl14ep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00694:Arl14ep APN 2 106967192 missense probably damaging 0.99
IGL02014:Arl14ep APN 2 106967113 missense probably benign 0.00
IGL02837:Arl14ep UTSW 2 106969229 missense probably damaging 1.00
R4938:Arl14ep UTSW 2 106969318 missense probably damaging 1.00
R5830:Arl14ep UTSW 2 106969194 missense possibly damaging 0.50
R5859:Arl14ep UTSW 2 106969053 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACACTGTAGAAAGCACAATGGC -3'
(R):5'- CTTCTATACTCGGCACACAGG -3'

Sequencing Primer
(F):5'- GCCTCTATACATACATCTGAGTCGGG -3'
(R):5'- TCGGCACACAGGTTTCAAG -3'
Posted On2020-09-02