Incidental Mutation 'R8387:Zfp345'
ID 647192
Institutional Source Beutler Lab
Gene Symbol Zfp345
Ensembl Gene ENSMUSG00000074731
Gene Name zinc finger protein 345
Synonyms OTTMUSG00000015743
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock # R8387 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 150470991-150485091 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 150472820 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 266 (T266A)
Ref Sequence ENSEMBL: ENSMUSP00000105540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109914]
AlphaFold A2AQA1
Predicted Effect probably damaging
Transcript: ENSMUST00000109914
AA Change: T266A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105540
Gene: ENSMUSG00000074731
AA Change: T266A

DomainStartEndE-ValueType
KRAB 4 66 9.5e-20 SMART
ZnF_C2H2 103 125 2e-2 SMART
ZnF_C2H2 131 153 2.9e-6 SMART
ZnF_C2H2 159 181 4.1e-3 SMART
ZnF_C2H2 215 237 2.6e-7 SMART
ZnF_C2H2 243 265 1.6e-5 SMART
ZnF_C2H2 271 293 4e-7 SMART
ZnF_C2H2 299 321 1.1e-5 SMART
ZnF_C2H2 327 349 5.9e-7 SMART
ZnF_C2H2 365 387 4.4e-7 SMART
ZnF_C2H2 393 415 7.3e-6 SMART
ZnF_C2H2 421 443 2.7e-5 SMART
ZnF_C2H2 449 471 1.5e-4 SMART
ZnF_C2H2 477 499 1.3e-5 SMART
ZnF_C2H2 505 527 5.1e-6 SMART
ZnF_C2H2 533 555 9.2e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Arl14ep T C 2: 106,969,217 D93G probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpa3 T C 3: 20,227,236 I169V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dab2ip T A 2: 35,719,858 I695K probably damaging Het
Dhtkd1 C A 2: 5,929,668 L230F possibly damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Flvcr1 A G 1: 191,011,534 probably null Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Ktn1 T A 14: 47,707,287 probably null Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Mapk8ip2 T C 15: 89,460,694 F765L probably damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Nr4a1 T C 15: 101,273,172 S510P probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1218 T C 2: 89,055,302 I41M probably benign Het
Olfr1394 T C 11: 49,160,670 S219P probably damaging Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pias4 G A 10: 81,154,508 R398C probably benign Het
Plekha6 A T 1: 133,292,155 probably null Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Ptprr A G 10: 116,251,125 Y503C probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Tox3 A G 8: 90,257,967 S195P probably benign Het
Trim44 T C 2: 102,400,173 E171G probably damaging Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Vmn2r77 C A 7: 86,801,739 Q278K probably benign Het
Other mutations in Zfp345
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Zfp345 APN 2 150472729 missense probably damaging 1.00
IGL00846:Zfp345 APN 2 150472618 missense possibly damaging 0.76
IGL01020:Zfp345 APN 2 150473047 missense possibly damaging 0.68
IGL01931:Zfp345 APN 2 150473350 missense probably benign 0.38
IGL02237:Zfp345 APN 2 150474885 splice site probably benign
IGL02335:Zfp345 APN 2 150474543 missense possibly damaging 0.92
IGL02592:Zfp345 APN 2 150473309 missense probably benign 0.36
IGL02736:Zfp345 APN 2 150474554 missense probably damaging 0.99
R0095:Zfp345 UTSW 2 150472300 missense probably damaging 1.00
R0096:Zfp345 UTSW 2 150472300 missense probably damaging 1.00
R0143:Zfp345 UTSW 2 150472555 missense probably benign
R0371:Zfp345 UTSW 2 150472063 missense possibly damaging 0.81
R0412:Zfp345 UTSW 2 150473403 missense probably benign 0.00
R0415:Zfp345 UTSW 2 150474559 splice site probably benign
R0420:Zfp345 UTSW 2 150473243 missense possibly damaging 0.74
R0697:Zfp345 UTSW 2 150472909 missense probably benign 0.13
R0799:Zfp345 UTSW 2 150472351 missense probably benign 0.27
R1881:Zfp345 UTSW 2 150472355 missense probably damaging 1.00
R1954:Zfp345 UTSW 2 150474821 missense probably damaging 1.00
R2004:Zfp345 UTSW 2 150472118 missense possibly damaging 0.90
R2152:Zfp345 UTSW 2 150472658 missense probably benign 0.00
R2153:Zfp345 UTSW 2 150472658 missense probably benign 0.00
R3051:Zfp345 UTSW 2 150474852 missense probably benign 0.07
R3880:Zfp345 UTSW 2 150472155 missense possibly damaging 0.91
R3939:Zfp345 UTSW 2 150472553 missense probably damaging 1.00
R4801:Zfp345 UTSW 2 150473308 missense possibly damaging 0.91
R4802:Zfp345 UTSW 2 150473308 missense possibly damaging 0.91
R4897:Zfp345 UTSW 2 150472688 missense probably benign 0.05
R5606:Zfp345 UTSW 2 150474868 nonsense probably null
R6009:Zfp345 UTSW 2 150472517 missense probably damaging 1.00
R6191:Zfp345 UTSW 2 150473090 missense probably benign 0.11
R6194:Zfp345 UTSW 2 150472631 missense probably damaging 1.00
R6782:Zfp345 UTSW 2 150473354 missense probably damaging 0.97
R6932:Zfp345 UTSW 2 150473411 missense probably damaging 0.99
R7356:Zfp345 UTSW 2 150472289 missense probably damaging 1.00
R7980:Zfp345 UTSW 2 150472803 nonsense probably null
R8515:Zfp345 UTSW 2 150472428 missense probably benign 0.01
R8940:Zfp345 UTSW 2 150472357 missense probably benign 0.40
R9038:Zfp345 UTSW 2 150471944 missense probably benign 0.02
R9383:Zfp345 UTSW 2 150472583 missense possibly damaging 0.89
R9480:Zfp345 UTSW 2 150473292 nonsense probably null
R9723:Zfp345 UTSW 2 150472269 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAAAGGATTTACCACATTCGTT -3'
(R):5'- TATCATAAAAGAACACATGCTGGAG -3'

Sequencing Primer
(F):5'- AGGAGATGACTCTTTCTTGCAAAGG -3'
(R):5'- CACATGCTGGAGAGAGACCATATG -3'
Posted On 2020-09-02