Incidental Mutation 'R8387:Zfp345'
ID647192
Institutional Source Beutler Lab
Gene Symbol Zfp345
Ensembl Gene ENSMUSG00000074731
Gene Namezinc finger protein 345
SynonymsOTTMUSG00000015743
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #R8387 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location150470991-150485091 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150472820 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 266 (T266A)
Ref Sequence ENSEMBL: ENSMUSP00000105540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109914]
Predicted Effect probably damaging
Transcript: ENSMUST00000109914
AA Change: T266A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105540
Gene: ENSMUSG00000074731
AA Change: T266A

DomainStartEndE-ValueType
KRAB 4 66 9.5e-20 SMART
ZnF_C2H2 103 125 2e-2 SMART
ZnF_C2H2 131 153 2.9e-6 SMART
ZnF_C2H2 159 181 4.1e-3 SMART
ZnF_C2H2 215 237 2.6e-7 SMART
ZnF_C2H2 243 265 1.6e-5 SMART
ZnF_C2H2 271 293 4e-7 SMART
ZnF_C2H2 299 321 1.1e-5 SMART
ZnF_C2H2 327 349 5.9e-7 SMART
ZnF_C2H2 365 387 4.4e-7 SMART
ZnF_C2H2 393 415 7.3e-6 SMART
ZnF_C2H2 421 443 2.7e-5 SMART
ZnF_C2H2 449 471 1.5e-4 SMART
ZnF_C2H2 477 499 1.3e-5 SMART
ZnF_C2H2 505 527 5.1e-6 SMART
ZnF_C2H2 533 555 9.2e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Arl14ep T C 2: 106,969,217 D93G probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpa3 T C 3: 20,227,236 I169V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dab2ip T A 2: 35,719,858 I695K probably damaging Het
Dhtkd1 C A 2: 5,929,668 L230F possibly damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Flvcr1 A G 1: 191,011,534 probably null Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Mapk8ip2 T C 15: 89,460,694 F765L probably damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Nr4a1 T C 15: 101,273,172 S510P probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1218 T C 2: 89,055,302 I41M probably benign Het
Olfr1394 T C 11: 49,160,670 S219P probably damaging Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pias4 G A 10: 81,154,508 R398C probably benign Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Ptprr A G 10: 116,251,125 Y503C probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Tox3 A G 8: 90,257,967 S195P probably benign Het
Trim44 T C 2: 102,400,173 E171G probably damaging Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Vmn2r77 C A 7: 86,801,739 Q278K probably benign Het
Other mutations in Zfp345
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Zfp345 APN 2 150472729 missense probably damaging 1.00
IGL00846:Zfp345 APN 2 150472618 missense possibly damaging 0.76
IGL01020:Zfp345 APN 2 150473047 missense possibly damaging 0.68
IGL01931:Zfp345 APN 2 150473350 missense probably benign 0.38
IGL02237:Zfp345 APN 2 150474885 splice site probably benign
IGL02335:Zfp345 APN 2 150474543 missense possibly damaging 0.92
IGL02592:Zfp345 APN 2 150473309 missense probably benign 0.36
IGL02736:Zfp345 APN 2 150474554 missense probably damaging 0.99
R0095:Zfp345 UTSW 2 150472300 missense probably damaging 1.00
R0096:Zfp345 UTSW 2 150472300 missense probably damaging 1.00
R0143:Zfp345 UTSW 2 150472555 missense probably benign
R0371:Zfp345 UTSW 2 150472063 missense possibly damaging 0.81
R0412:Zfp345 UTSW 2 150473403 missense probably benign 0.00
R0415:Zfp345 UTSW 2 150474559 splice site probably benign
R0420:Zfp345 UTSW 2 150473243 missense possibly damaging 0.74
R0697:Zfp345 UTSW 2 150472909 missense probably benign 0.13
R0799:Zfp345 UTSW 2 150472351 missense probably benign 0.27
R1881:Zfp345 UTSW 2 150472355 missense probably damaging 1.00
R1954:Zfp345 UTSW 2 150474821 missense probably damaging 1.00
R2004:Zfp345 UTSW 2 150472118 missense possibly damaging 0.90
R2152:Zfp345 UTSW 2 150472658 missense probably benign 0.00
R2153:Zfp345 UTSW 2 150472658 missense probably benign 0.00
R3051:Zfp345 UTSW 2 150474852 missense probably benign 0.07
R3880:Zfp345 UTSW 2 150472155 missense possibly damaging 0.91
R3939:Zfp345 UTSW 2 150472553 missense probably damaging 1.00
R4801:Zfp345 UTSW 2 150473308 missense possibly damaging 0.91
R4802:Zfp345 UTSW 2 150473308 missense possibly damaging 0.91
R4897:Zfp345 UTSW 2 150472688 missense probably benign 0.05
R5606:Zfp345 UTSW 2 150474868 nonsense probably null
R6009:Zfp345 UTSW 2 150472517 missense probably damaging 1.00
R6191:Zfp345 UTSW 2 150473090 missense probably benign 0.11
R6194:Zfp345 UTSW 2 150472631 missense probably damaging 1.00
R6782:Zfp345 UTSW 2 150473354 missense probably damaging 0.97
R6932:Zfp345 UTSW 2 150473411 missense probably damaging 0.99
R7356:Zfp345 UTSW 2 150472289 missense probably damaging 1.00
R7980:Zfp345 UTSW 2 150472803 nonsense probably null
R8515:Zfp345 UTSW 2 150472428 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCAAAGGATTTACCACATTCGTT -3'
(R):5'- TATCATAAAAGAACACATGCTGGAG -3'

Sequencing Primer
(F):5'- AGGAGATGACTCTTTCTTGCAAAGG -3'
(R):5'- CACATGCTGGAGAGAGACCATATG -3'
Posted On2020-09-02