Incidental Mutation 'R8387:Cpa3'
ID647193
Institutional Source Beutler Lab
Gene Symbol Cpa3
Ensembl Gene ENSMUSG00000001865
Gene Namecarboxypeptidase A3, mast cell
SynonymsMC-CPA, mast cell carboxypeptidase A, mMC-CPA
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8387 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location20215620-20242181 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20227236 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 169 (I169V)
Ref Sequence ENSEMBL: ENSMUSP00000001921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001921]
Predicted Effect probably benign
Transcript: ENSMUST00000001921
AA Change: I169V

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000001921
Gene: ENSMUSG00000001865
AA Change: I169V

DomainStartEndE-ValueType
Pfam:Propep_M14 27 103 9.5e-21 PFAM
Zn_pept 119 400 3.77e-127 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the carboxypeptidase A family of zinc metalloproteases and preproprotein that is proteolytically processed to generate a mature protein product. This product is released by mast cells and may be involved in the degradation of endogenous proteins and the inactivation of venom-associated peptides. Homozygous knockout mice for this gene exhibit impaired mast cell development. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice have immature peritoneal mast cells but normal mast cell functions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Arl14ep T C 2: 106,969,217 D93G probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dab2ip T A 2: 35,719,858 I695K probably damaging Het
Dhtkd1 C A 2: 5,929,668 L230F possibly damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Flvcr1 A G 1: 191,011,534 probably null Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Mapk8ip2 T C 15: 89,460,694 F765L probably damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Nr4a1 T C 15: 101,273,172 S510P probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1218 T C 2: 89,055,302 I41M probably benign Het
Olfr1394 T C 11: 49,160,670 S219P probably damaging Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pias4 G A 10: 81,154,508 R398C probably benign Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Ptprr A G 10: 116,251,125 Y503C probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Tox3 A G 8: 90,257,967 S195P probably benign Het
Trim44 T C 2: 102,400,173 E171G probably damaging Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Vmn2r77 C A 7: 86,801,739 Q278K probably benign Het
Zfp345 T C 2: 150,472,820 T266A probably damaging Het
Other mutations in Cpa3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Cpa3 APN 3 20228815 missense possibly damaging 0.95
IGL02471:Cpa3 APN 3 20228807 critical splice donor site probably null
IGL02605:Cpa3 APN 3 20222212 missense probably benign 0.15
IGL03333:Cpa3 APN 3 20215828 missense possibly damaging 0.52
IGL03351:Cpa3 APN 3 20215962 missense probably benign
R0084:Cpa3 UTSW 3 20242101 splice site probably benign
R0632:Cpa3 UTSW 3 20225194 missense probably benign 0.00
R1017:Cpa3 UTSW 3 20239633 missense possibly damaging 0.86
R1334:Cpa3 UTSW 3 20222223 missense probably damaging 1.00
R1796:Cpa3 UTSW 3 20223227 splice site probably null
R2310:Cpa3 UTSW 3 20227223 missense probably damaging 1.00
R3945:Cpa3 UTSW 3 20225117 missense probably damaging 1.00
R4467:Cpa3 UTSW 3 20228817 nonsense probably null
R4551:Cpa3 UTSW 3 20219770 missense probably benign 0.37
R4927:Cpa3 UTSW 3 20222139 missense probably damaging 1.00
R5159:Cpa3 UTSW 3 20227223 missense probably damaging 1.00
R5307:Cpa3 UTSW 3 20227163 critical splice donor site probably null
R5564:Cpa3 UTSW 3 20242143 missense possibly damaging 0.84
R6477:Cpa3 UTSW 3 20239575 missense possibly damaging 0.81
R7624:Cpa3 UTSW 3 20225143 missense possibly damaging 0.86
R8279:Cpa3 UTSW 3 20223314 missense possibly damaging 0.70
R8302:Cpa3 UTSW 3 20222152 missense probably damaging 1.00
R8418:Cpa3 UTSW 3 20222151 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGACTTCTCTAACTAGGTGG -3'
(R):5'- CAGCTCTGAACCTTGGGAAATTTC -3'

Sequencing Primer
(F):5'- TGGAACACTTCTCATTTGGAAAGGG -3'
(R):5'- TGTAACAGAAGATGAACTATGAATGG -3'
Posted On2020-09-02