Incidental Mutation 'R8387:Tox3'
ID647209
Institutional Source Beutler Lab
Gene Symbol Tox3
Ensembl Gene ENSMUSG00000043668
Gene NameTOX high mobility group box family member 3
SynonymsCAGF9, Tnrc9, 500-9
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.888) question?
Stock #R8387 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location90247040-90348343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90257967 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 195 (S195P)
Ref Sequence ENSEMBL: ENSMUSP00000105250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109621] [ENSMUST00000176034] [ENSMUST00000176616]
Predicted Effect probably benign
Transcript: ENSMUST00000109621
AA Change: S195P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105250
Gene: ENSMUSG00000043668
AA Change: S195P

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 195 214 N/A INTRINSIC
HMG 253 323 2.93e-19 SMART
low complexity region 345 362 N/A INTRINSIC
coiled coil region 438 466 N/A INTRINSIC
low complexity region 548 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176034
AA Change: S173P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134931
Gene: ENSMUSG00000043668
AA Change: S173P

DomainStartEndE-ValueType
low complexity region 38 55 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176616
AA Change: S194P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135697
Gene: ENSMUSG00000043668
AA Change: S194P

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 194 213 N/A INTRINSIC
HMG 252 309 1.29e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an HMG-box, indicating that it may be involved in bending and unwinding of DNA and alteration of chromatin structure. The C-terminus of the encoded protein is glutamine-rich due to CAG repeats in the coding sequence. A minor allele of this gene has been implicated in an elevated risk of breast cancer. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Arl14ep T C 2: 106,969,217 D93G probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpa3 T C 3: 20,227,236 I169V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dab2ip T A 2: 35,719,858 I695K probably damaging Het
Dhtkd1 C A 2: 5,929,668 L230F possibly damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Flvcr1 A G 1: 191,011,534 probably null Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Mapk8ip2 T C 15: 89,460,694 F765L probably damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Nr4a1 T C 15: 101,273,172 S510P probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1218 T C 2: 89,055,302 I41M probably benign Het
Olfr1394 T C 11: 49,160,670 S219P probably damaging Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pias4 G A 10: 81,154,508 R398C probably benign Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Ptprr A G 10: 116,251,125 Y503C probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Trim44 T C 2: 102,400,173 E171G probably damaging Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Vmn2r77 C A 7: 86,801,739 Q278K probably benign Het
Zfp345 T C 2: 150,472,820 T266A probably damaging Het
Other mutations in Tox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Tox3 APN 8 90270434 missense probably damaging 1.00
IGL02417:Tox3 APN 8 90258131 missense possibly damaging 0.52
IGL02447:Tox3 APN 8 90258153 splice site probably benign
R1139:Tox3 UTSW 8 90248869 missense probably damaging 1.00
R1472:Tox3 UTSW 8 90254345 missense probably damaging 1.00
R1892:Tox3 UTSW 8 90270241 missense probably benign 0.31
R1906:Tox3 UTSW 8 90248429 unclassified probably benign
R2847:Tox3 UTSW 8 90248390 nonsense probably null
R2849:Tox3 UTSW 8 90248390 nonsense probably null
R3703:Tox3 UTSW 8 90248905 missense possibly damaging 0.52
R3705:Tox3 UTSW 8 90248905 missense possibly damaging 0.52
R4984:Tox3 UTSW 8 90248642 unclassified probably benign
R5249:Tox3 UTSW 8 90248816 missense probably benign 0.09
R5722:Tox3 UTSW 8 90347861 critical splice donor site probably null
R6291:Tox3 UTSW 8 90248938 missense probably damaging 1.00
R6451:Tox3 UTSW 8 90258059 missense probably benign 0.31
R7653:Tox3 UTSW 8 90248989 missense probably damaging 1.00
R7753:Tox3 UTSW 8 90248932 missense probably damaging 1.00
R8220:Tox3 UTSW 8 90258080 missense probably damaging 0.97
R8337:Tox3 UTSW 8 90347879 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATCAACTGAAAAGTGTCTCCC -3'
(R):5'- TGTAGGATCAGAGCCACACAC -3'

Sequencing Primer
(F):5'- GGAAGGTGATCCTCCAAATGCC -3'
(R):5'- CAAGTGTCACAGTACCGCCAG -3'
Posted On2020-09-02