Incidental Mutation 'R8387:Pias4'
ID647213
Institutional Source Beutler Lab
Gene Symbol Pias4
Ensembl Gene ENSMUSG00000004934
Gene Nameprotein inhibitor of activated STAT 4
SynonymsPIASy
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.898) question?
Stock #R8387 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location81153266-81167923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81154508 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 398 (R398C)
Ref Sequence ENSEMBL: ENSMUSP00000005064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005064] [ENSMUST00000048128] [ENSMUST00000121840] [ENSMUST00000135765]
Predicted Effect probably benign
Transcript: ENSMUST00000005064
AA Change: R398C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005064
Gene: ENSMUSG00000004934
AA Change: R398C

DomainStartEndE-ValueType
SAP 12 46 4.44e-7 SMART
Pfam:PINIT 123 270 9.6e-35 PFAM
Pfam:zf-MIZ 315 364 2.4e-24 PFAM
low complexity region 429 454 N/A INTRINSIC
low complexity region 469 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000048128
SMART Domains Protein: ENSMUSP00000047333
Gene: ENSMUSG00000035011

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
ZnF_C2H2 404 426 2.79e-4 SMART
ZnF_C2H2 432 454 1.58e-3 SMART
ZnF_C2H2 460 480 5.4e1 SMART
low complexity region 486 519 N/A INTRINSIC
low complexity region 528 535 N/A INTRINSIC
low complexity region 546 563 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121840
SMART Domains Protein: ENSMUSP00000113787
Gene: ENSMUSG00000035011

DomainStartEndE-ValueType
BTB 34 131 5.01e-30 SMART
low complexity region 195 205 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
low complexity region 245 261 N/A INTRINSIC
low complexity region 267 289 N/A INTRINSIC
low complexity region 297 314 N/A INTRINSIC
ZnF_C2H2 376 398 7.55e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135765
SMART Domains Protein: ENSMUSP00000121361
Gene: ENSMUSG00000004934

DomainStartEndE-ValueType
PDB:4FO9|A 1 70 9e-15 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants display mild postnatal lethality or a normal phenotype depending on strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Arl14ep T C 2: 106,969,217 D93G probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpa3 T C 3: 20,227,236 I169V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dab2ip T A 2: 35,719,858 I695K probably damaging Het
Dhtkd1 C A 2: 5,929,668 L230F possibly damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Flvcr1 A G 1: 191,011,534 probably null Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Mapk8ip2 T C 15: 89,460,694 F765L probably damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Nr4a1 T C 15: 101,273,172 S510P probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1218 T C 2: 89,055,302 I41M probably benign Het
Olfr1394 T C 11: 49,160,670 S219P probably damaging Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Ptprr A G 10: 116,251,125 Y503C probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Tox3 A G 8: 90,257,967 S195P probably benign Het
Trim44 T C 2: 102,400,173 E171G probably damaging Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Vmn2r77 C A 7: 86,801,739 Q278K probably benign Het
Zfp345 T C 2: 150,472,820 T266A probably damaging Het
Other mutations in Pias4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Pias4 APN 10 81155658 missense probably benign 0.07
IGL01790:Pias4 APN 10 81157498 missense probably damaging 0.98
IGL02553:Pias4 APN 10 81163787 missense probably damaging 1.00
IGL02670:Pias4 APN 10 81164070 missense probably damaging 0.99
petrified_forest UTSW 10 81155855 missense probably damaging 1.00
R0083:Pias4 UTSW 10 81164166 missense probably damaging 1.00
R0122:Pias4 UTSW 10 81157087 missense probably damaging 0.96
R0711:Pias4 UTSW 10 81157530 unclassified probably benign
R1399:Pias4 UTSW 10 81155675 missense probably damaging 1.00
R1726:Pias4 UTSW 10 81155855 missense probably damaging 1.00
R1907:Pias4 UTSW 10 81154363 missense possibly damaging 0.46
R3730:Pias4 UTSW 10 81164054 missense probably damaging 0.98
R4764:Pias4 UTSW 10 81164034 missense possibly damaging 0.88
R4790:Pias4 UTSW 10 81157492 missense probably damaging 0.98
R4808:Pias4 UTSW 10 81155840 splice site probably null
R6351:Pias4 UTSW 10 81157264 missense probably damaging 1.00
R6786:Pias4 UTSW 10 81157246 missense probably damaging 1.00
R7113:Pias4 UTSW 10 81154453 missense possibly damaging 0.94
R7260:Pias4 UTSW 10 81157468 missense possibly damaging 0.95
R7487:Pias4 UTSW 10 81163972 missense probably benign
R7609:Pias4 UTSW 10 81158026 splice site probably null
R8224:Pias4 UTSW 10 81167731 start gained probably benign
R8443:Pias4 UTSW 10 81157010 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCATCTTCCGAGGACGACGAG -3'
(R):5'- GGAAGTTAGTCAGAGCTCTTCAG -3'

Sequencing Primer
(F):5'- ACGAGCTGTCCAGTGTGAG -3'
(R):5'- GCTCTTCAGCCCACAGG -3'
Posted On2020-09-02