Incidental Mutation 'R8387:Ptprr'
ID647214
Institutional Source Beutler Lab
Gene Symbol Ptprr
Ensembl Gene ENSMUSG00000020151
Gene Nameprotein tyrosine phosphatase, receptor type, R
SynonymsPTPBR7, PTP-SL, RPTPRR
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R8387 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location116018213-116274932 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116251125 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 503 (Y503C)
Ref Sequence ENSEMBL: ENSMUSP00000064392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063470] [ENSMUST00000105271] [ENSMUST00000128399] [ENSMUST00000148731] [ENSMUST00000155606]
Predicted Effect probably damaging
Transcript: ENSMUST00000063470
AA Change: Y503C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064392
Gene: ENSMUSG00000020151
AA Change: Y503C

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 226 248 N/A INTRINSIC
PTPc 391 648 3.74e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105271
AA Change: Y396C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100907
Gene: ENSMUSG00000020151
AA Change: Y396C

DomainStartEndE-ValueType
transmembrane domain 119 141 N/A INTRINSIC
PTPc 284 541 3.74e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000128399
AA Change: Y259C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114455
Gene: ENSMUSG00000020151
AA Change: Y259C

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148731
AA Change: Y259C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120965
Gene: ENSMUSG00000020151
AA Change: Y259C

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000155606
AA Change: Y259C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122259
Gene: ENSMUSG00000020151
AA Change: Y259C

DomainStartEndE-ValueType
PTPc 147 404 3.74e-108 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and a single intracellular catalytic domain, and thus represents a receptor-type PTP. Silencing of this gene has been associated with colorectal cancer. Multiple transcript variants encoding different isoforms have been found for this gene. This gene shares a symbol (PTPRQ) with another gene, protein tyrosine phosphatase, receptor type, Q (GeneID 374462), which is also located on chromosome 12. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased ERK1/2 phosphorylation levels in cerebellar Purkinje cells, decreased grip strength, and ataxia characterized by fine motor coordination and balance defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Arl14ep T C 2: 106,969,217 D93G probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpa3 T C 3: 20,227,236 I169V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dab2ip T A 2: 35,719,858 I695K probably damaging Het
Dhtkd1 C A 2: 5,929,668 L230F possibly damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Flvcr1 A G 1: 191,011,534 probably null Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Mapk8ip2 T C 15: 89,460,694 F765L probably damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Nr4a1 T C 15: 101,273,172 S510P probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1218 T C 2: 89,055,302 I41M probably benign Het
Olfr1394 T C 11: 49,160,670 S219P probably damaging Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pias4 G A 10: 81,154,508 R398C probably benign Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Tox3 A G 8: 90,257,967 S195P probably benign Het
Trim44 T C 2: 102,400,173 E171G probably damaging Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Vmn2r77 C A 7: 86,801,739 Q278K probably benign Het
Zfp345 T C 2: 150,472,820 T266A probably damaging Het
Other mutations in Ptprr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Ptprr APN 10 116188317 missense probably benign 0.00
IGL01762:Ptprr APN 10 116236733 missense probably damaging 1.00
IGL02429:Ptprr APN 10 116273767 missense probably damaging 0.99
IGL03396:Ptprr APN 10 116188330 missense probably damaging 1.00
R0268:Ptprr UTSW 10 116252963 missense possibly damaging 0.83
R0584:Ptprr UTSW 10 116251158 missense probably damaging 0.96
R1388:Ptprr UTSW 10 116273752 missense probably benign 0.14
R1438:Ptprr UTSW 10 116256204 missense probably damaging 0.98
R1533:Ptprr UTSW 10 116188208 nonsense probably null
R1654:Ptprr UTSW 10 116188363 missense probably benign 0.43
R1793:Ptprr UTSW 10 116252922 missense probably damaging 1.00
R4081:Ptprr UTSW 10 116236710 missense probably benign 0.01
R4193:Ptprr UTSW 10 116252864 missense probably damaging 1.00
R4254:Ptprr UTSW 10 116162443 splice site probably null
R4496:Ptprr UTSW 10 116229502 missense possibly damaging 0.91
R4799:Ptprr UTSW 10 116048218 missense probably benign 0.00
R5209:Ptprr UTSW 10 116162609 missense probably damaging 0.99
R5312:Ptprr UTSW 10 116188419 missense probably benign 0.28
R5410:Ptprr UTSW 10 116188330 missense possibly damaging 0.94
R5556:Ptprr UTSW 10 116251149 missense probably damaging 0.96
R5717:Ptprr UTSW 10 116048113 missense probably benign 0.11
R6039:Ptprr UTSW 10 116236763 splice site probably null
R6039:Ptprr UTSW 10 116236763 splice site probably null
R7013:Ptprr UTSW 10 116236754 missense probably damaging 1.00
R7401:Ptprr UTSW 10 116048236 missense probably benign
R7527:Ptprr UTSW 10 116251199 missense probably benign 0.08
R7644:Ptprr UTSW 10 116048228 missense probably benign 0.00
R7651:Ptprr UTSW 10 116251179 missense probably benign 0.01
R7708:Ptprr UTSW 10 116162597 missense probably benign 0.31
R7731:Ptprr UTSW 10 116237295 missense probably damaging 1.00
R8026:Ptprr UTSW 10 116048170 missense probably damaging 1.00
R8261:Ptprr UTSW 10 116237264 missense possibly damaging 0.95
R8358:Ptprr UTSW 10 116048275 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TATTATGGTCTGGTCTGCACATC -3'
(R):5'- GACGTCGATAGCTTGCCTTTG -3'

Sequencing Primer
(F):5'- GGTCTGCACATCATAGAGTTCAC -3'
(R):5'- AGCTTTCACAAGTTGTATCTGTTAGG -3'
Posted On2020-09-02