Incidental Mutation 'R8387:Olfr1394'
ID647217
Institutional Source Beutler Lab
Gene Symbol Olfr1394
Ensembl Gene ENSMUSG00000048378
Gene Nameolfactory receptor 1394
SynonymsMOR280-1, GA_x6K02T2QP88-6274566-6273628
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R8387 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location49154377-49162854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49160670 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 219 (S219P)
Ref Sequence ENSEMBL: ENSMUSP00000149520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046522] [ENSMUST00000052668] [ENSMUST00000216273]
Predicted Effect probably benign
Transcript: ENSMUST00000046522
SMART Domains Protein: ENSMUSP00000046229
Gene: ENSMUSG00000040283

DomainStartEndE-ValueType
IG 44 151 1.24e-8 SMART
Pfam:Ig_2 155 243 9.2e-3 PFAM
Pfam:C2-set_2 156 238 1.7e-9 PFAM
transmembrane domain 259 281 N/A INTRINSIC
PRY 324 377 8.68e-14 SMART
SPRY 378 503 1.3e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000052668
AA Change: S219P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063062
Gene: ENSMUSG00000048378
AA Change: S219P

DomainStartEndE-ValueType
Pfam:7tm_4 30 309 6.5e-53 PFAM
Pfam:7TM_GPCR_Srsx 37 233 3e-5 PFAM
Pfam:7tm_1 43 292 2.1e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216273
AA Change: S219P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Arl14ep T C 2: 106,969,217 D93G probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpa3 T C 3: 20,227,236 I169V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dab2ip T A 2: 35,719,858 I695K probably damaging Het
Dhtkd1 C A 2: 5,929,668 L230F possibly damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Flvcr1 A G 1: 191,011,534 probably null Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Mapk8ip2 T C 15: 89,460,694 F765L probably damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Nr4a1 T C 15: 101,273,172 S510P probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1218 T C 2: 89,055,302 I41M probably benign Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pias4 G A 10: 81,154,508 R398C probably benign Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Ptprr A G 10: 116,251,125 Y503C probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Tox3 A G 8: 90,257,967 S195P probably benign Het
Trim44 T C 2: 102,400,173 E171G probably damaging Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Vmn2r77 C A 7: 86,801,739 Q278K probably benign Het
Zfp345 T C 2: 150,472,820 T266A probably damaging Het
Other mutations in Olfr1394
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Olfr1394 APN 11 49160674 missense probably damaging 1.00
IGL01603:Olfr1394 APN 11 49160611 missense probably damaging 1.00
IGL01736:Olfr1394 APN 11 49160527 missense probably damaging 1.00
IGL02246:Olfr1394 APN 11 49160094 missense probably benign 0.44
IGL02321:Olfr1394 APN 11 49160775 missense probably damaging 1.00
IGL03405:Olfr1394 APN 11 49160886 splice site probably null
R0358:Olfr1394 UTSW 11 49160244 missense probably benign 0.00
R1967:Olfr1394 UTSW 11 49160848 missense probably benign 0.06
R2472:Olfr1394 UTSW 11 49160371 missense possibly damaging 0.76
R3824:Olfr1394 UTSW 11 49160793 missense possibly damaging 0.48
R4105:Olfr1394 UTSW 11 49160548 missense possibly damaging 0.51
R4255:Olfr1394 UTSW 11 49160435 nonsense probably null
R4716:Olfr1394 UTSW 11 49160890 missense probably damaging 1.00
R5545:Olfr1394 UTSW 11 49160626 missense probably damaging 1.00
R6894:Olfr1394 UTSW 11 49160359 missense probably benign 0.06
R6999:Olfr1394 UTSW 11 49160412 missense possibly damaging 0.53
R8077:Olfr1394 UTSW 11 49160485 missense probably damaging 1.00
R8266:Olfr1394 UTSW 11 49160525 nonsense probably null
Z1177:Olfr1394 UTSW 11 49160298 missense possibly damaging 0.82
Z1177:Olfr1394 UTSW 11 49160865 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGGCCTGCTCTTTCTTGGC -3'
(R):5'- GAAGATGGAGGTGGCTCTATCC -3'

Sequencing Primer
(F):5'- CATGGCAGACAGTGTGATTG -3'
(R):5'- ATCCCCCAGTGGTGTTCTAG -3'
Posted On2020-09-02