Incidental Mutation 'R8387:Smyd4'
ID647218
Institutional Source Beutler Lab
Gene Symbol Smyd4
Ensembl Gene ENSMUSG00000018809
Gene NameSET and MYND domain containing 4
SynonymsG430029E23Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8387 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location75348433-75405705 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75402158 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 638 (N638S)
Ref Sequence ENSEMBL: ENSMUSP00000047505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044530]
Predicted Effect probably benign
Transcript: ENSMUST00000044530
AA Change: N638S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000047505
Gene: ENSMUSG00000018809
AA Change: N638S

DomainStartEndE-ValueType
Pfam:TPR_11 65 132 2.4e-10 PFAM
SET 231 576 4.85e-1 SMART
Blast:TPR 694 726 1e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135774
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit testicular degeneration and atrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Arl14ep T C 2: 106,969,217 D93G probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpa3 T C 3: 20,227,236 I169V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dab2ip T A 2: 35,719,858 I695K probably damaging Het
Dhtkd1 C A 2: 5,929,668 L230F possibly damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Flvcr1 A G 1: 191,011,534 probably null Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Mapk8ip2 T C 15: 89,460,694 F765L probably damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Nr4a1 T C 15: 101,273,172 S510P probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1218 T C 2: 89,055,302 I41M probably benign Het
Olfr1394 T C 11: 49,160,670 S219P probably damaging Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pias4 G A 10: 81,154,508 R398C probably benign Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Ptprr A G 10: 116,251,125 Y503C probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Tox3 A G 8: 90,257,967 S195P probably benign Het
Trim44 T C 2: 102,400,173 E171G probably damaging Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Vmn2r77 C A 7: 86,801,739 Q278K probably benign Het
Zfp345 T C 2: 150,472,820 T266A probably damaging Het
Other mutations in Smyd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Smyd4 APN 11 75390808 missense probably benign
IGL02372:Smyd4 APN 11 75390285 nonsense probably null
IGL02390:Smyd4 APN 11 75387506 splice site probably null
IGL02492:Smyd4 APN 11 75403426 missense probably benign
IGL02504:Smyd4 APN 11 75390681 missense probably damaging 1.00
IGL02623:Smyd4 APN 11 75390064 splice site probably benign
IGL02661:Smyd4 APN 11 75390941 nonsense probably null
IGL03084:Smyd4 APN 11 75390607 missense probably benign 0.00
PIT4431001:Smyd4 UTSW 11 75403513 missense probably damaging 1.00
R0507:Smyd4 UTSW 11 75399708 missense possibly damaging 0.69
R0834:Smyd4 UTSW 11 75391132 missense possibly damaging 0.94
R1075:Smyd4 UTSW 11 75400338 missense probably damaging 1.00
R1215:Smyd4 UTSW 11 75390295 missense possibly damaging 0.96
R1759:Smyd4 UTSW 11 75382366 missense probably damaging 1.00
R2496:Smyd4 UTSW 11 75391101 missense probably benign 0.03
R2862:Smyd4 UTSW 11 75390136 missense probably benign 0.12
R4033:Smyd4 UTSW 11 75349754 missense probably benign 0.06
R4655:Smyd4 UTSW 11 75390732 missense probably damaging 1.00
R4775:Smyd4 UTSW 11 75391192 missense probably damaging 1.00
R4801:Smyd4 UTSW 11 75403184 missense probably damaging 1.00
R4802:Smyd4 UTSW 11 75403184 missense probably damaging 1.00
R4963:Smyd4 UTSW 11 75382294 missense probably benign 0.01
R5306:Smyd4 UTSW 11 75402158 missense probably benign 0.00
R5327:Smyd4 UTSW 11 75390939 missense probably damaging 1.00
R5386:Smyd4 UTSW 11 75390156 missense probably damaging 1.00
R5578:Smyd4 UTSW 11 75404776 missense probably benign 0.03
R7038:Smyd4 UTSW 11 75390514 missense probably damaging 1.00
R7271:Smyd4 UTSW 11 75390499 missense possibly damaging 0.90
R7312:Smyd4 UTSW 11 75390256 missense probably benign 0.18
R7576:Smyd4 UTSW 11 75390206 missense probably benign 0.03
R7904:Smyd4 UTSW 11 75349787 missense possibly damaging 0.80
Z1176:Smyd4 UTSW 11 75399614 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTAAACCTCAGAGTGGGATTAGCTG -3'
(R):5'- CTGCTCAGTAAGGCAAGGTG -3'

Sequencing Primer
(F):5'- ATCAGAATTCACTCAGGCCTTG -3'
(R):5'- TGCTCAGTAAGGCAAGGTGATACC -3'
Posted On2020-09-02