Incidental Mutation 'R8387:Mapk8ip2'
ID647220
Institutional Source Beutler Lab
Gene Symbol Mapk8ip2
Ensembl Gene ENSMUSG00000022619
Gene Namemitogen-activated protein kinase 8 interacting protein 2
SynonymsIB2, Jip2, 3230402N03Rik, JNK-interacting protein
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.531) question?
Stock #R8387 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location89453913-89464468 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89460694 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 765 (F765L)
Ref Sequence ENSEMBL: ENSMUSP00000023291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023291]
Predicted Effect probably damaging
Transcript: ENSMUST00000023291
AA Change: F765L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023291
Gene: ENSMUSG00000022619
AA Change: F765L

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 85 104 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 271 295 N/A INTRINSIC
low complexity region 300 324 N/A INTRINSIC
low complexity region 419 437 N/A INTRINSIC
low complexity region 472 490 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
low complexity region 589 598 N/A INTRINSIC
SH3 613 670 2.24e-10 SMART
PTB 684 823 1.19e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is closely related to MAPK8IP1/IB1/JIP-1, a scaffold protein that is involved in the c-Jun amino-terminal kinase signaling pathway. This protein is expressed in brain and pancreatic cells. It has been shown to interact with, and regulate the activity of MAPK8/JNK1, and MAP2K7/MKK7 kinases. This protein thus is thought to function as a regulator of signal transduction by protein kinase cascade in brain and pancreatic beta-cells. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a null allele are smaller in size and exhibit male infertility. Mice homozygous for a different knock-out allele exhibit behavioral and cerebellar transmission deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Arl14ep T C 2: 106,969,217 D93G probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpa3 T C 3: 20,227,236 I169V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dab2ip T A 2: 35,719,858 I695K probably damaging Het
Dhtkd1 C A 2: 5,929,668 L230F possibly damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Flvcr1 A G 1: 191,011,534 probably null Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Nr4a1 T C 15: 101,273,172 S510P probably damaging Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1218 T C 2: 89,055,302 I41M probably benign Het
Olfr1394 T C 11: 49,160,670 S219P probably damaging Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pias4 G A 10: 81,154,508 R398C probably benign Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Ptprr A G 10: 116,251,125 Y503C probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Tox3 A G 8: 90,257,967 S195P probably benign Het
Trim44 T C 2: 102,400,173 E171G probably damaging Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Vmn2r77 C A 7: 86,801,739 Q278K probably benign Het
Zfp345 T C 2: 150,472,820 T266A probably damaging Het
Other mutations in Mapk8ip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01942:Mapk8ip2 APN 15 89457017 critical splice donor site probably null
IGL02720:Mapk8ip2 APN 15 89457582 missense probably damaging 1.00
IGL02741:Mapk8ip2 APN 15 89457497 missense probably damaging 1.00
IGL03027:Mapk8ip2 APN 15 89458107 missense probably damaging 1.00
PIT4520001:Mapk8ip2 UTSW 15 89460697 missense probably damaging 1.00
R0504:Mapk8ip2 UTSW 15 89456658 missense possibly damaging 0.62
R2355:Mapk8ip2 UTSW 15 89458965 missense probably benign 0.04
R3026:Mapk8ip2 UTSW 15 89461446 missense probably damaging 1.00
R3430:Mapk8ip2 UTSW 15 89457282 missense possibly damaging 0.86
R4275:Mapk8ip2 UTSW 15 89458995 missense probably damaging 1.00
R4789:Mapk8ip2 UTSW 15 89459038 missense probably damaging 1.00
R4953:Mapk8ip2 UTSW 15 89457228 missense probably benign
R5209:Mapk8ip2 UTSW 15 89459287 missense probably damaging 1.00
R5417:Mapk8ip2 UTSW 15 89457439 missense probably benign 0.16
R5521:Mapk8ip2 UTSW 15 89458804 missense probably damaging 1.00
R6860:Mapk8ip2 UTSW 15 89460452 missense probably damaging 1.00
R7145:Mapk8ip2 UTSW 15 89458998 missense possibly damaging 0.67
R7231:Mapk8ip2 UTSW 15 89458076 missense probably benign
R7369:Mapk8ip2 UTSW 15 89454251 missense probably benign 0.01
R7753:Mapk8ip2 UTSW 15 89461653 missense probably damaging 1.00
R7827:Mapk8ip2 UTSW 15 89458119 missense probably damaging 0.98
R7834:Mapk8ip2 UTSW 15 89461373 missense probably damaging 1.00
R8433:Mapk8ip2 UTSW 15 89457866 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACCTTGAGATCTCTCTGCGG -3'
(R):5'- ATGTAGGACTGCAGCTGGAC -3'

Sequencing Primer
(F):5'- GGGGGTCAAGCTGAGTCTC -3'
(R):5'- TATGGGTGGAGCCCTAAG -3'
Posted On2020-09-02