Incidental Mutation 'R8387:Nr4a1'
ID647221
Institutional Source Beutler Lab
Gene Symbol Nr4a1
Ensembl Gene ENSMUSG00000023034
Gene Namenuclear receptor subfamily 4, group A, member 1
SynonymsTR3, Hbr1, Hmr, Gfrp, Hbr-1, NP10, GFRP1, NGFI-B, TIS1, Nur77, N10
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8387 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location101254269-101274795 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101273172 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 510 (S510P)
Ref Sequence ENSEMBL: ENSMUSP00000023779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023779] [ENSMUST00000228985] [ENSMUST00000230814]
Predicted Effect probably damaging
Transcript: ENSMUST00000023779
AA Change: S510P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023779
Gene: ENSMUSG00000023034
AA Change: S510P

DomainStartEndE-ValueType
low complexity region 37 52 N/A INTRINSIC
low complexity region 77 102 N/A INTRINSIC
low complexity region 183 204 N/A INTRINSIC
ZnF_C4 267 338 1.93e-37 SMART
HOLI 411 569 3.77e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228985
AA Change: S510P

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000230814
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the steroid-thyroid hormone-retinoid receptor superfamily. Expression is induced by phytohemagglutinin in human lymphocytes and by serum stimulation of arrested fibroblasts. The encoded protein acts as a nuclear transcription factor. Translocation of the protein from the nucleus to mitochondria induces apoptosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile, and display a normal HPA axis function, as well as normal thymic and peripheral T cell deletion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b G A 5: 8,824,698 D453N probably damaging Het
Arl14ep T C 2: 106,969,217 D93G probably damaging Het
Bcl7b T C 5: 135,168,559 I18T probably damaging Het
Cdh1 A G 8: 106,663,869 I614V probably benign Het
Cpa3 T C 3: 20,227,236 I169V probably benign Het
Cpeb4 T C 11: 31,908,877 probably null Het
Csmd1 G A 8: 16,000,484 H2251Y possibly damaging Het
Dab2ip T A 2: 35,719,858 I695K probably damaging Het
Dhtkd1 C A 2: 5,929,668 L230F possibly damaging Het
Emc1 T C 4: 139,361,289 S353P probably benign Het
Erc2 T A 14: 27,653,296 L157Q possibly damaging Het
Flvcr1 A G 1: 191,011,534 probably null Het
Fryl A C 5: 73,136,320 probably null Het
Gnl2 T C 4: 125,055,334 *729Q probably null Het
Gpr63 G A 4: 25,008,301 V342M possibly damaging Het
Guf1 C T 5: 69,566,467 P463L probably damaging Het
Hmmr G A 11: 40,721,672 S206F probably damaging Het
Ifngr2 T C 16: 91,561,647 L245P probably damaging Het
Igsf10 A G 3: 59,329,143 F1206L probably damaging Het
Lekr1 A G 3: 65,684,099 K86E possibly damaging Het
Lrrc3 C T 10: 77,901,512 G30D possibly damaging Het
Mapk8ip2 T C 15: 89,460,694 F765L probably damaging Het
Myo6 A G 9: 80,276,350 T676A unknown Het
Olfr1205 G A 2: 88,831,289 M57I possibly damaging Het
Olfr1218 T C 2: 89,055,302 I41M probably benign Het
Olfr1394 T C 11: 49,160,670 S219P probably damaging Het
Olfr558 C T 7: 102,710,195 T312I probably benign Het
Olfr76 A G 19: 12,120,421 L97P probably damaging Het
Pdcd1 G A 1: 94,041,468 L42F probably damaging Het
Pdzd7 T C 19: 45,030,051 D621G probably damaging Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Pias4 G A 10: 81,154,508 R398C probably benign Het
Prkag3 A G 1: 74,745,695 probably null Het
Ptpn7 A G 1: 135,133,868 T23A probably benign Het
Ptprd T C 4: 75,955,289 D1069G probably damaging Het
Ptprr A G 10: 116,251,125 Y503C probably damaging Het
Slc26a8 T C 17: 28,647,925 D610G probably benign Het
Smyd4 A G 11: 75,402,158 N638S probably benign Het
Tenm3 A G 8: 48,287,848 F1200S probably damaging Het
Tox3 A G 8: 90,257,967 S195P probably benign Het
Trim44 T C 2: 102,400,173 E171G probably damaging Het
Vars T A 17: 35,010,514 M369K probably damaging Het
Vmn2r77 C A 7: 86,801,739 Q278K probably benign Het
Zfp345 T C 2: 150,472,820 T266A probably damaging Het
Other mutations in Nr4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Nr4a1 APN 15 101270899 missense probably damaging 1.00
IGL00966:Nr4a1 APN 15 101272788 missense probably damaging 1.00
IGL01326:Nr4a1 APN 15 101274059 missense probably damaging 1.00
R0539:Nr4a1 UTSW 15 101270884 missense probably damaging 1.00
R1853:Nr4a1 UTSW 15 101271764 missense probably benign 0.00
R1854:Nr4a1 UTSW 15 101271764 missense probably benign 0.00
R1909:Nr4a1 UTSW 15 101274227 missense probably damaging 1.00
R2073:Nr4a1 UTSW 15 101274067 missense probably damaging 0.96
R2392:Nr4a1 UTSW 15 101274194 missense possibly damaging 0.70
R2402:Nr4a1 UTSW 15 101271737 missense probably damaging 0.98
R3001:Nr4a1 UTSW 15 101270972 splice site probably null
R3002:Nr4a1 UTSW 15 101270972 splice site probably null
R4190:Nr4a1 UTSW 15 101274112 missense probably damaging 1.00
R5218:Nr4a1 UTSW 15 101272153 missense probably benign 0.02
R6363:Nr4a1 UTSW 15 101274115 missense probably damaging 1.00
R7559:Nr4a1 UTSW 15 101270899 missense probably damaging 1.00
R7910:Nr4a1 UTSW 15 101271760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCTGCCAGATCTAAACCCG -3'
(R):5'- ATCCCTAAGCTAGATGCCCAGC -3'

Sequencing Primer
(F):5'- TGCCAGATCTAAACCCGGTGAG -3'
(R):5'- TACAGTCGTACCTGAGGAGTC -3'
Posted On2020-09-02