Incidental Mutation 'R8389:Adamtsl2'
ID 647264
Institutional Source Beutler Lab
Gene Symbol Adamtsl2
Ensembl Gene ENSMUSG00000036040
Gene Name ADAMTS-like 2
Synonyms A930008K15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8389 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 27079379-27108981 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 27103124 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 722 (D722G)
Ref Sequence ENSEMBL: ENSMUSP00000088774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091233]
AlphaFold Q7TSK7
Predicted Effect possibly damaging
Transcript: ENSMUST00000091233
AA Change: D722G

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040
AA Change: D722G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSP1 50 106 5.14e-7 SMART
Pfam:ADAM_spacer1 214 331 5.4e-28 PFAM
low complexity region 345 358 N/A INTRINSIC
TSP1 573 629 8.15e-1 SMART
TSP1 631 692 1.85e-2 SMART
TSP1 694 744 4.15e-1 SMART
TSP1 747 796 9.98e-5 SMART
TSP1 803 861 4.95e-2 SMART
TSP1 863 914 2.53e-6 SMART
Pfam:PLAC 922 953 1.4e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl C T 1: 66,854,747 G83E probably damaging Het
Akap11 A T 14: 78,518,882 D25E Het
Akr1c21 C T 13: 4,576,279 R101W probably damaging Het
Ano2 T C 6: 125,980,169 Y634H probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
C87414 A T 5: 93,637,728 F231Y probably benign Het
Cfap221 T C 1: 119,923,571 E820G probably damaging Het
Chad A G 11: 94,567,892 D289G probably benign Het
Col4a2 C A 8: 11,448,132 A1647E probably damaging Het
Dhx32 G T 7: 133,725,206 T522K possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eloa A G 4: 136,006,311 V707A probably benign Het
Fam219a A G 4: 41,520,935 S109P probably damaging Het
Ftl1 A T 7: 45,459,227 F36I probably benign Het
Furin C T 7: 80,390,879 R737Q probably benign Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gpt C T 15: 76,699,042 T393M probably damaging Het
Greb1l A T 18: 10,529,613 D865V probably benign Het
Ifi207 GTT GT 1: 173,729,450 probably null Het
Klk1b11 G A 7: 43,999,696 C219Y probably damaging Het
Lcn11 A T 2: 25,779,031 D117V probably damaging Het
Lrpprc A T 17: 84,773,314 V161D possibly damaging Het
Lrrk2 T C 15: 91,699,991 L318S probably damaging Het
Muc5b A G 7: 141,861,779 T2821A possibly damaging Het
Mysm1 A G 4: 94,965,612 M250T probably benign Het
Nol12 A G 15: 78,935,068 K27E probably damaging Het
Olfr1186 G A 2: 88,525,587 M1I probably null Het
Olfr951 A G 9: 39,394,616 K272R probably damaging Het
Omg T A 11: 79,502,175 M286L probably benign Het
Pdyn A G 2: 129,688,437 L104P probably benign Het
Pira2 A C 7: 3,843,889 L218R probably damaging Het
Pnpt1 A T 11: 29,130,758 M1L unknown Het
Pofut2 C T 10: 77,265,951 T274M probably benign Het
Rbm12b1 C A 4: 12,146,363 D778E probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Tbc1d14 G A 5: 36,530,448 probably benign Het
Tcf23 A G 5: 30,970,120 K89E probably benign Het
Tmem74 C T 15: 43,866,919 G243R probably damaging Het
Ufd1 T C 16: 18,821,103 V119A possibly damaging Het
Vmn2r72 A T 7: 85,751,960 Y84N probably damaging Het
Zfp120 A T 2: 150,117,407 C354S probably damaging Het
Zfp69 G A 4: 120,949,352 T28I possibly damaging Het
Zfp959 T C 17: 55,897,299 V112A probably benign Het
Zfr2 T A 10: 81,245,489 W458R probably benign Het
Other mutations in Adamtsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Adamtsl2 APN 2 27085088 missense probably damaging 1.00
IGL01902:Adamtsl2 APN 2 27087252 missense probably damaging 1.00
IGL02207:Adamtsl2 APN 2 27102981 missense probably damaging 0.99
IGL02247:Adamtsl2 APN 2 27084893 missense probably damaging 1.00
IGL02253:Adamtsl2 APN 2 27098697 missense possibly damaging 0.48
IGL02655:Adamtsl2 APN 2 27082530 splice site probably benign
IGL03148:Adamtsl2 APN 2 27084059 missense probably damaging 0.99
IGL03269:Adamtsl2 APN 2 27108355 nonsense probably null
R0609:Adamtsl2 UTSW 2 27089635 missense probably benign 0.25
R1183:Adamtsl2 UTSW 2 27084080 missense probably damaging 1.00
R1443:Adamtsl2 UTSW 2 27103066 missense possibly damaging 0.89
R1675:Adamtsl2 UTSW 2 27082485 frame shift probably null
R1698:Adamtsl2 UTSW 2 27103127 missense possibly damaging 0.92
R1765:Adamtsl2 UTSW 2 27102830 missense probably benign 0.01
R1934:Adamtsl2 UTSW 2 27089593 missense probably damaging 0.99
R2106:Adamtsl2 UTSW 2 27102825 missense probably benign 0.02
R2108:Adamtsl2 UTSW 2 27095558 missense probably benign
R2189:Adamtsl2 UTSW 2 27081738 missense probably benign 0.00
R2232:Adamtsl2 UTSW 2 27103178 missense probably damaging 1.00
R4301:Adamtsl2 UTSW 2 27087283 missense probably null 1.00
R4518:Adamtsl2 UTSW 2 27095547 missense probably benign 0.00
R4572:Adamtsl2 UTSW 2 27083256 missense probably damaging 0.99
R4627:Adamtsl2 UTSW 2 27093585 missense probably damaging 0.99
R4668:Adamtsl2 UTSW 2 27095475 missense probably benign 0.00
R4686:Adamtsl2 UTSW 2 27093825 missense probably damaging 0.99
R4821:Adamtsl2 UTSW 2 27098592 splice site probably null
R5054:Adamtsl2 UTSW 2 27101720 missense probably damaging 1.00
R5460:Adamtsl2 UTSW 2 27095398 splice site probably null
R5569:Adamtsl2 UTSW 2 27102833 missense probably damaging 1.00
R5694:Adamtsl2 UTSW 2 27081724 missense probably benign 0.03
R6836:Adamtsl2 UTSW 2 27081706 start codon destroyed probably null 0.90
R7103:Adamtsl2 UTSW 2 27107461 missense probably damaging 1.00
R7437:Adamtsl2 UTSW 2 27089709 missense probably damaging 0.99
R8089:Adamtsl2 UTSW 2 27104797 missense probably benign 0.00
X0003:Adamtsl2 UTSW 2 27081772 small deletion probably benign
X0003:Adamtsl2 UTSW 2 27081773 small deletion probably benign
Z1176:Adamtsl2 UTSW 2 27081720 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CACAGTGGGAGATGTCTGAG -3'
(R):5'- GTTTGAGTCCCTACACGAGTGG -3'

Sequencing Primer
(F):5'- CAGTGGGAGATGTCTGAGTGGTC -3'
(R):5'- TGTCTCTTTACTCCACATAGATGAG -3'
Posted On 2020-09-02