Incidental Mutation 'R8389:Olfr1186'
ID647265
Institutional Source Beutler Lab
Gene Symbol Olfr1186
Ensembl Gene ENSMUSG00000082882
Gene Nameolfactory receptor 1186
SynonymsGA_x6K02T2Q125-50012960-50013871, MOR230-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8389 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88518551-88526790 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) G to A at 88525587 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 1 (M1I)
Ref Sequence ENSEMBL: ENSMUSP00000151114 (fasta)
Predicted Effect probably null
Transcript: ENSMUST00000121619
AA Change: M1I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably null
Transcript: ENSMUST00000215912
AA Change: M1I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably null
Transcript: ENSMUST00000216978
AA Change: M1I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl C T 1: 66,854,747 G83E probably damaging Het
Adamtsl2 A G 2: 27,103,124 D722G possibly damaging Het
Akap11 A T 14: 78,518,882 D25E Het
Akr1c21 C T 13: 4,576,279 R101W probably damaging Het
Ano2 T C 6: 125,980,169 Y634H probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
C87414 A T 5: 93,637,728 F231Y probably benign Het
Cfap221 T C 1: 119,923,571 E820G probably damaging Het
Chad A G 11: 94,567,892 D289G probably benign Het
Col4a2 C A 8: 11,448,132 A1647E probably damaging Het
Dhx32 G T 7: 133,725,206 T522K possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eloa A G 4: 136,006,311 V707A probably benign Het
Fam219a A G 4: 41,520,935 S109P probably damaging Het
Ftl1 A T 7: 45,459,227 F36I probably benign Het
Furin C T 7: 80,390,879 R737Q probably benign Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gpt C T 15: 76,699,042 T393M probably damaging Het
Greb1l A T 18: 10,529,613 D865V probably benign Het
Ifi207 GTT GT 1: 173,729,450 probably null Het
Klk1b11 G A 7: 43,999,696 C219Y probably damaging Het
Lcn11 A T 2: 25,779,031 D117V probably damaging Het
Lrpprc A T 17: 84,773,314 V161D possibly damaging Het
Lrrk2 T C 15: 91,699,991 L318S probably damaging Het
Muc5b A G 7: 141,861,779 T2821A possibly damaging Het
Mysm1 A G 4: 94,965,612 M250T probably benign Het
Nol12 A G 15: 78,935,068 K27E probably damaging Het
Olfr951 A G 9: 39,394,616 K272R probably damaging Het
Omg T A 11: 79,502,175 M286L probably benign Het
Pdyn A G 2: 129,688,437 L104P probably benign Het
Pira2 A C 7: 3,843,889 L218R probably damaging Het
Pnpt1 A T 11: 29,130,758 M1L unknown Het
Pofut2 C T 10: 77,265,951 T274M probably benign Het
Rbm12b1 C A 4: 12,146,363 D778E probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Tbc1d14 G A 5: 36,530,448 probably benign Het
Tcf23 A G 5: 30,970,120 K89E probably benign Het
Tmem74 C T 15: 43,866,919 G243R probably damaging Het
Ufd1 T C 16: 18,821,103 V119A possibly damaging Het
Vmn2r72 A T 7: 85,751,960 Y84N probably damaging Het
Zfp120 A T 2: 150,117,407 C354S probably damaging Het
Zfp69 G A 4: 120,949,352 T28I possibly damaging Het
Zfp959 T C 17: 55,897,299 V112A probably benign Het
Zfr2 T A 10: 81,245,489 W458R probably benign Het
Other mutations in Olfr1186
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Olfr1186 APN 2 88525760 missense possibly damaging 0.87
IGL01727:Olfr1186 APN 2 88525927 missense probably benign 0.03
IGL01790:Olfr1186 APN 2 88526423 missense probably damaging 0.99
IGL01868:Olfr1186 APN 2 88525715 missense possibly damaging 0.66
IGL03146:Olfr1186 APN 2 88526144 missense possibly damaging 0.90
IGL03378:Olfr1186 APN 2 88526154 nonsense probably null
R0053:Olfr1186 UTSW 2 88526163 missense probably damaging 1.00
R0829:Olfr1186 UTSW 2 88526228 missense probably damaging 1.00
R1210:Olfr1186 UTSW 2 88526276 missense possibly damaging 0.89
R1754:Olfr1186 UTSW 2 88525815 missense probably damaging 0.99
R2260:Olfr1186 UTSW 2 88526386 missense possibly damaging 0.93
R3426:Olfr1186 UTSW 2 88525864 missense probably damaging 1.00
R3781:Olfr1186 UTSW 2 88526365 missense probably benign 0.23
R4737:Olfr1186 UTSW 2 88526225 missense probably damaging 1.00
R4908:Olfr1186 UTSW 2 88525910 missense probably damaging 1.00
R4932:Olfr1186 UTSW 2 88525735 missense probably benign 0.02
R5071:Olfr1186 UTSW 2 88526041 missense probably damaging 1.00
R5831:Olfr1186 UTSW 2 88526480 nonsense probably null
R6222:Olfr1186 UTSW 2 88499270 missense probably benign 0.34
R6370:Olfr1186 UTSW 2 88499368 nonsense probably null
R6802:Olfr1186 UTSW 2 88525597 missense probably benign 0.02
R6931:Olfr1186 UTSW 2 88526194 missense possibly damaging 0.50
R7044:Olfr1186 UTSW 2 88526486 missense probably benign
R7121:Olfr1186 UTSW 2 88525826 missense probably damaging 1.00
R7166:Olfr1186 UTSW 2 88525646 missense possibly damaging 0.89
R7387:Olfr1186 UTSW 2 88526400 nonsense probably null
R7891:Olfr1186 UTSW 2 88525945 missense probably benign 0.04
R7951:Olfr1186 UTSW 2 88525804 missense probably damaging 0.98
R7978:Olfr1186 UTSW 2 88525670 nonsense probably null
R8016:Olfr1186 UTSW 2 88526173 missense probably damaging 0.99
R8039:Olfr1186 UTSW 2 88525871 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TCCAATCCAGTAAGTTTCTGAGTC -3'
(R):5'- TGTAGTTGTAGAGAAGCAAGCATC -3'

Sequencing Primer
(F):5'- ATCCAGTAAGTTTCTGAGTCATTGG -3'
(R):5'- GCATCAGCGAAAGATAAATAGAAGAG -3'
Posted On2020-09-02