Incidental Mutation 'R8389:Zfp69'
ID647272
Institutional Source Beutler Lab
Gene Symbol Zfp69
Ensembl Gene ENSMUSG00000064141
Gene Namezinc finger protein 69
SynonymsZfp63, LOC381549, KRAB2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8389 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location120930137-120951699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120949352 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 28 (T28I)
Ref Sequence ENSEMBL: ENSMUSP00000101888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106280] [ENSMUST00000106281] [ENSMUST00000130702]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106280
AA Change: T28I

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101887
Gene: ENSMUSG00000064141
AA Change: T28I

DomainStartEndE-ValueType
internal_repeat_1 32 80 1.53e-8 PROSPERO
KRAB 131 192 1.15e-32 SMART
ZnF_C2H2 324 346 1.13e-4 SMART
ZnF_C2H2 352 374 2.79e-4 SMART
ZnF_C2H2 380 402 1.04e-3 SMART
ZnF_C2H2 408 430 1.12e-3 SMART
ZnF_C2H2 436 458 1.82e-3 SMART
ZnF_C2H2 464 486 3.29e-1 SMART
ZnF_C2H2 492 514 1.38e-3 SMART
ZnF_C2H2 520 542 3.29e-1 SMART
ZnF_C2H2 548 570 2.12e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106281
AA Change: T28I

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101888
Gene: ENSMUSG00000064141
AA Change: T28I

DomainStartEndE-ValueType
internal_repeat_1 32 80 1.53e-8 PROSPERO
KRAB 131 192 1.15e-32 SMART
ZnF_C2H2 324 346 1.13e-4 SMART
ZnF_C2H2 352 374 2.79e-4 SMART
ZnF_C2H2 380 402 1.04e-3 SMART
ZnF_C2H2 408 430 1.12e-3 SMART
ZnF_C2H2 436 458 1.82e-3 SMART
ZnF_C2H2 464 486 3.29e-1 SMART
ZnF_C2H2 492 514 1.38e-3 SMART
ZnF_C2H2 520 542 3.29e-1 SMART
ZnF_C2H2 548 570 2.12e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130702
SMART Domains Protein: ENSMUSP00000133312
Gene: ENSMUSG00000064141

DomainStartEndE-ValueType
KRAB 1 32 2.6e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acadl C T 1: 66,854,747 G83E probably damaging Het
Adamtsl2 A G 2: 27,103,124 D722G possibly damaging Het
Akap11 A T 14: 78,518,882 D25E Het
Akr1c21 C T 13: 4,576,279 R101W probably damaging Het
Ano2 T C 6: 125,980,169 Y634H probably damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
C87414 A T 5: 93,637,728 F231Y probably benign Het
Cfap221 T C 1: 119,923,571 E820G probably damaging Het
Chad A G 11: 94,567,892 D289G probably benign Het
Col4a2 C A 8: 11,448,132 A1647E probably damaging Het
Dhx32 G T 7: 133,725,206 T522K possibly damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eloa A G 4: 136,006,311 V707A probably benign Het
Fam219a A G 4: 41,520,935 S109P probably damaging Het
Ftl1 A T 7: 45,459,227 F36I probably benign Het
Furin C T 7: 80,390,879 R737Q probably benign Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gpt C T 15: 76,699,042 T393M probably damaging Het
Greb1l A T 18: 10,529,613 D865V probably benign Het
Ifi207 GTT GT 1: 173,729,450 probably null Het
Klk1b11 G A 7: 43,999,696 C219Y probably damaging Het
Lcn11 A T 2: 25,779,031 D117V probably damaging Het
Lrpprc A T 17: 84,773,314 V161D possibly damaging Het
Lrrk2 T C 15: 91,699,991 L318S probably damaging Het
Muc5b A G 7: 141,861,779 T2821A possibly damaging Het
Mysm1 A G 4: 94,965,612 M250T probably benign Het
Nol12 A G 15: 78,935,068 K27E probably damaging Het
Olfr1186 G A 2: 88,525,587 M1I probably null Het
Olfr951 A G 9: 39,394,616 K272R probably damaging Het
Omg T A 11: 79,502,175 M286L probably benign Het
Pdyn A G 2: 129,688,437 L104P probably benign Het
Pira2 A C 7: 3,843,889 L218R probably damaging Het
Pnpt1 A T 11: 29,130,758 M1L unknown Het
Pofut2 C T 10: 77,265,951 T274M probably benign Het
Rbm12b1 C A 4: 12,146,363 D778E probably damaging Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
Tbc1d14 G A 5: 36,530,448 probably benign Het
Tcf23 A G 5: 30,970,120 K89E probably benign Het
Tmem74 C T 15: 43,866,919 G243R probably damaging Het
Ufd1 T C 16: 18,821,103 V119A possibly damaging Het
Vmn2r72 A T 7: 85,751,960 Y84N probably damaging Het
Zfp120 A T 2: 150,117,407 C354S probably damaging Het
Zfp959 T C 17: 55,897,299 V112A probably benign Het
Zfr2 T A 10: 81,245,489 W458R probably benign Het
Other mutations in Zfp69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Zfp69 APN 4 120931500 missense probably damaging 1.00
IGL02604:Zfp69 APN 4 120931463 missense probably benign 0.10
IGL03406:Zfp69 APN 4 120931084 missense probably benign
R0505:Zfp69 UTSW 4 120931095 missense probably damaging 1.00
R0613:Zfp69 UTSW 4 120934347 missense probably benign
R0628:Zfp69 UTSW 4 120949425 nonsense probably null
R0838:Zfp69 UTSW 4 120931281 missense probably benign 0.09
R1669:Zfp69 UTSW 4 120947498 utr 5 prime probably benign
R2060:Zfp69 UTSW 4 120930832 missense probably damaging 0.98
R3740:Zfp69 UTSW 4 120930874 splice site probably null
R4242:Zfp69 UTSW 4 120934475 intron probably benign
R4770:Zfp69 UTSW 4 120934417 missense probably damaging 0.99
R4998:Zfp69 UTSW 4 120947325 missense possibly damaging 0.52
R5620:Zfp69 UTSW 4 120930522 missense probably damaging 1.00
R6312:Zfp69 UTSW 4 120949517 unclassified probably benign
R6534:Zfp69 UTSW 4 120931197 missense probably benign 0.05
R7056:Zfp69 UTSW 4 120931098 missense probably benign 0.01
R7061:Zfp69 UTSW 4 120931401 missense possibly damaging 0.69
R7663:Zfp69 UTSW 4 120935126 missense probably benign 0.17
R8169:Zfp69 UTSW 4 120930534 missense probably damaging 1.00
R8348:Zfp69 UTSW 4 120930637 missense probably damaging 1.00
RF053:Zfp69 UTSW 4 120947347 utr 5 prime probably benign
Predicted Primers PCR Primer
(F):5'- AGTTAGGCTCTCACACGCAG -3'
(R):5'- TGGCCTGAGGACGATACAAC -3'

Sequencing Primer
(F):5'- CCTGTTATATATTGTTTCTGGGGAC -3'
(R):5'- ACCAGGAAGCCTCTCATCG -3'
Posted On2020-09-02