Incidental Mutation 'R8390:Tnrc6a'
ID647328
Institutional Source Beutler Lab
Gene Symbol Tnrc6a
Ensembl Gene ENSMUSG00000052707
Gene Nametrinucleotide repeat containing 6a
SynonymsCAGH26, 2010321I05Rik, Tnrc6, 3110054G10Rik, D130023A07Rik
MMRRC Submission
Accession Numbers

Genbank: NM_144925; MGI: 2385292

Is this an essential gene? Probably essential (E-score: 0.834) question?
Stock #R8390 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location123123885-123195296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123162571 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 81 (T81A)
Ref Sequence ENSEMBL: ENSMUSP00000091595 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094053] [ENSMUST00000205514] [ENSMUST00000206888]
Predicted Effect probably damaging
Transcript: ENSMUST00000094053
AA Change: T81A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091595
Gene: ENSMUSG00000052707
AA Change: T81A

DomainStartEndE-ValueType
coiled coil region 5 54 N/A INTRINSIC
low complexity region 69 92 N/A INTRINSIC
low complexity region 93 113 N/A INTRINSIC
low complexity region 281 294 N/A INTRINSIC
low complexity region 430 443 N/A INTRINSIC
low complexity region 568 590 N/A INTRINSIC
internal_repeat_1 690 853 3.51e-6 PROSPERO
low complexity region 858 871 N/A INTRINSIC
Pfam:Ago_hook 1028 1190 1.2e-29 PFAM
low complexity region 1284 1296 N/A INTRINSIC
low complexity region 1301 1316 N/A INTRINSIC
low complexity region 1337 1376 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
Pfam:TNRC6-PABC_bdg 1439 1714 1.5e-126 PFAM
RRM 1717 1784 4.95e-2 SMART
low complexity region 1808 1820 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205514
Predicted Effect probably benign
Transcript: ENSMUST00000206888
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the trinucleotide repeat containing 6 protein family. The protein is highly similar to a human protein that functions in post-transcriptional gene silencing through the RNA interference (RNAi) and microRNA pathways. The human protein associates with messenger RNAs and argonaute proteins in cytoplasmic bodies known as GW-bodies or P-bodies, and inhibiting its expression delocalizes other GW-body proteins and impairs RNAi and microRNA-induced gene silencing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit partial embryonic lethality during organogenesis associated with impaired hematopoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(21) : Gene trapped(21)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,692,780 F50I unknown Het
Abca9 A T 11: 110,145,630 M551K probably benign Het
Adgrl3 T C 5: 81,766,210 S1145P probably damaging Het
BC053393 G T 11: 46,577,255 R52L probably damaging Het
Brix1 C T 15: 10,485,868 R9H probably benign Het
C1d T C 11: 17,263,993 V83A probably damaging Het
Ciz1 G T 2: 32,367,323 V127L probably benign Het
Csnk1g3 A T 18: 53,948,078 T374S probably benign Het
Elavl1 T A 8: 4,289,623 K320* probably null Het
Foxn3 T A 12: 99,388,741 M55L probably benign Het
Gm14399 A T 2: 175,130,812 Y383* probably null Het
H2-M10.5 T A 17: 36,774,595 H215Q probably benign Het
Hsd17b13 C A 5: 103,972,646 C80F probably damaging Het
Ifi206 G T 1: 173,480,945 T495N Het
Ifi207 GTT GT 1: 173,729,450 probably null Het
Ipo13 A T 4: 117,912,337 I86N probably damaging Het
Iqcf3 T G 9: 106,560,976 E16A unknown Het
Kcnh5 T A 12: 75,087,758 D339V probably damaging Het
Lmbr1 C T 5: 29,235,042 M441I probably benign Het
Me3 G T 7: 89,849,595 G461V probably damaging Het
Mepce A G 5: 137,785,179 L295P possibly damaging Het
Mtpap T A 18: 4,396,141 Y478N probably damaging Het
Myl12a T C 17: 70,996,236 M74V probably benign Het
Neil3 A T 8: 53,609,524 M99K probably damaging Het
Nlrp3 A G 11: 59,551,790 T723A possibly damaging Het
Obscn A T 11: 59,002,044 I6792N probably benign Het
Olfr1043 A G 2: 86,162,922 V9A possibly damaging Het
Olfr1100 G A 2: 86,978,157 T213I probably benign Het
Olfr525 G T 7: 140,323,114 W138C possibly damaging Het
Olfr715 A G 7: 107,129,315 L26P probably benign Het
Olfr913 T A 9: 38,594,591 Y123* probably null Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pitx2 C A 3: 129,218,858 N312K probably damaging Het
Pot1b C A 17: 55,692,739 V229L probably benign Het
Psmd1 A G 1: 86,078,607 I232V possibly damaging Het
Rif1 A G 2: 52,110,923 E1463G probably damaging Het
Scn5a T A 9: 119,539,538 Y307F possibly damaging Het
Shprh G A 10: 11,187,983 E1267K possibly damaging Het
Smtnl1 A T 2: 84,815,350 Y392* probably null Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Sspo G A 6: 48,467,962 G2268R probably benign Het
Tex47 G A 5: 7,305,301 E161K probably benign Het
Tmem236 T C 2: 14,219,357 L319P probably damaging Het
Tnk1 T C 11: 69,851,869 T606A possibly damaging Het
Trav6d-4 A T 14: 52,753,635 T46S probably benign Het
Wdr19 T A 5: 65,223,867 Y411* probably null Het
Zfp553 A G 7: 127,236,304 T344A probably damaging Het
Zfp62 G A 11: 49,215,192 G37S probably benign Het
Other mutations in Tnrc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Tnrc6a APN 7 123170780 missense probably benign 0.04
IGL00580:Tnrc6a APN 7 123174278 missense probably damaging 1.00
IGL01309:Tnrc6a APN 7 123171494 missense probably benign 0.04
IGL02004:Tnrc6a APN 7 123181366 missense possibly damaging 0.57
IGL02142:Tnrc6a APN 7 123152191 intron probably benign
IGL02220:Tnrc6a APN 7 123170456 missense probably benign
IGL02436:Tnrc6a APN 7 123184215 nonsense probably null
IGL02670:Tnrc6a APN 7 123171312 missense possibly damaging 0.92
IGL02743:Tnrc6a APN 7 123171473 missense probably damaging 1.00
0152:Tnrc6a UTSW 7 123180654 missense probably damaging 1.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0008:Tnrc6a UTSW 7 123170394 missense probably benign 0.00
R0369:Tnrc6a UTSW 7 123170860 missense probably damaging 1.00
R0512:Tnrc6a UTSW 7 123186728 splice site probably benign
R0566:Tnrc6a UTSW 7 123170913 missense probably benign 0.00
R0600:Tnrc6a UTSW 7 123171816 missense probably benign 0.14
R0751:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1184:Tnrc6a UTSW 7 123170340 missense possibly damaging 0.73
R1319:Tnrc6a UTSW 7 123184251 missense probably benign 0.02
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1405:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R1585:Tnrc6a UTSW 7 123176875 missense probably benign 0.08
R1709:Tnrc6a UTSW 7 123169982 missense probably benign 0.10
R1776:Tnrc6a UTSW 7 123171297 missense probably damaging 1.00
R1791:Tnrc6a UTSW 7 123192917 missense possibly damaging 0.47
R1807:Tnrc6a UTSW 7 123162446 splice site probably benign
R1876:Tnrc6a UTSW 7 123162446 splice site probably benign
R2010:Tnrc6a UTSW 7 123171046 missense probably benign 0.26
R2086:Tnrc6a UTSW 7 123162446 splice site probably benign
R2089:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2091:Tnrc6a UTSW 7 123172120 critical splice donor site probably null
R2511:Tnrc6a UTSW 7 123171092 missense probably damaging 1.00
R2830:Tnrc6a UTSW 7 123192949 makesense probably null
R2850:Tnrc6a UTSW 7 123179800 missense probably damaging 1.00
R3916:Tnrc6a UTSW 7 123181384 missense probably damaging 1.00
R4028:Tnrc6a UTSW 7 123170121 missense probably damaging 1.00
R4235:Tnrc6a UTSW 7 123171680 missense probably benign 0.00
R4439:Tnrc6a UTSW 7 123152182 nonsense probably null
R4525:Tnrc6a UTSW 7 123179782 missense probably benign
R4578:Tnrc6a UTSW 7 123184221 missense possibly damaging 0.89
R4613:Tnrc6a UTSW 7 123184289 critical splice donor site probably null
R4711:Tnrc6a UTSW 7 123171078 missense probably damaging 1.00
R4722:Tnrc6a UTSW 7 123192090 missense possibly damaging 0.78
R4746:Tnrc6a UTSW 7 123189997 missense probably damaging 1.00
R4892:Tnrc6a UTSW 7 123169911 missense probably damaging 1.00
R4942:Tnrc6a UTSW 7 123192613 missense probably damaging 0.99
R4967:Tnrc6a UTSW 7 123189872 missense probably damaging 1.00
R5064:Tnrc6a UTSW 7 123186723 critical splice donor site probably null
R5239:Tnrc6a UTSW 7 123186619 missense probably benign
R5604:Tnrc6a UTSW 7 123174236 missense probably damaging 0.97
R5805:Tnrc6a UTSW 7 123170076 missense probably damaging 0.97
R5942:Tnrc6a UTSW 7 123186665 missense probably damaging 1.00
R5988:Tnrc6a UTSW 7 123182380 missense probably damaging 0.96
R6212:Tnrc6a UTSW 7 123143742 splice site probably null
R6284:Tnrc6a UTSW 7 123171335 missense probably damaging 0.99
R6417:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6420:Tnrc6a UTSW 7 123171074 missense probably benign 0.01
R6575:Tnrc6a UTSW 7 123169910 missense probably damaging 1.00
R6760:Tnrc6a UTSW 7 123171999 missense probably damaging 1.00
R6886:Tnrc6a UTSW 7 123187445 missense probably benign 0.17
R6968:Tnrc6a UTSW 7 123182427 missense probably benign 0.05
R7216:Tnrc6a UTSW 7 123171495 missense probably benign 0.01
R7260:Tnrc6a UTSW 7 123186590 missense probably benign 0.36
R7299:Tnrc6a UTSW 7 123170913 missense probably benign
R7322:Tnrc6a UTSW 7 123171508 missense probably benign 0.09
R7500:Tnrc6a UTSW 7 123173450 splice site probably null
R7872:Tnrc6a UTSW 7 123179834 missense probably damaging 0.99
R8270:Tnrc6a UTSW 7 123170071 missense possibly damaging 0.92
R8313:Tnrc6a UTSW 7 123170713 missense possibly damaging 0.92
R8348:Tnrc6a UTSW 7 123192123 missense possibly damaging 0.65
R8448:Tnrc6a UTSW 7 123192123 missense possibly damaging 0.65
R8514:Tnrc6a UTSW 7 123184215 nonsense probably null
X0064:Tnrc6a UTSW 7 123169798 missense probably benign 0.28
Z1176:Tnrc6a UTSW 7 123162496 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGGTGTTCTGAAGCCTAAAGC -3'
(R):5'- TGCTGACCCCTCTTCAGAAG -3'

Sequencing Primer
(F):5'- CCTAAAGCTTCTGTTCAGGTTG -3'
(R):5'- GACCCCTCTTCAGAAGCTGTTTG -3'
Posted On2020-09-02