Incidental Mutation 'R8390:Shprh'
ID 647336
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene Name SNF2 histone linker PHD RING helicase
Synonyms 2610103K11Rik, D230017O13Rik
MMRRC Submission 067755-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8390 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 11149427-11217595 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 11187983 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1267 (E1267K)
Ref Sequence ENSEMBL: ENSMUSP00000039422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810]
AlphaFold Q7TPQ3
Predicted Effect possibly damaging
Transcript: ENSMUST00000044053
AA Change: E1267K

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: E1267K

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000054814
AA Change: E1267K

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: E1267K

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159541
AA Change: E1267K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: E1267K

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159810
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,692,780 (GRCm38) F50I unknown Het
Abca9 A T 11: 110,145,630 (GRCm38) M551K probably benign Het
Adgrl3 T C 5: 81,766,210 (GRCm38) S1145P probably damaging Het
BC053393 G T 11: 46,577,255 (GRCm38) R52L probably damaging Het
Brix1 C T 15: 10,485,868 (GRCm38) R9H probably benign Het
C1d T C 11: 17,263,993 (GRCm38) V83A probably damaging Het
Ciz1 G T 2: 32,367,323 (GRCm38) V127L probably benign Het
Csnk1g3 A T 18: 53,948,078 (GRCm38) T374S probably benign Het
Elavl1 T A 8: 4,289,623 (GRCm38) K320* probably null Het
Foxn3 T A 12: 99,388,741 (GRCm38) M55L probably benign Het
Gm14399 A T 2: 175,130,812 (GRCm38) Y383* probably null Het
H2-M10.5 T A 17: 36,774,595 (GRCm38) H215Q probably benign Het
Hsd17b13 C A 5: 103,972,646 (GRCm38) C80F probably damaging Het
Ifi206 G T 1: 173,480,945 (GRCm38) T495N Het
Ifi207 GTT GT 1: 173,729,450 (GRCm38) probably null Het
Ipo13 A T 4: 117,912,337 (GRCm38) I86N probably damaging Het
Iqcf3 T G 9: 106,560,976 (GRCm38) E16A unknown Het
Kcnh5 T A 12: 75,087,758 (GRCm38) D339V probably damaging Het
Lmbr1 C T 5: 29,235,042 (GRCm38) M441I probably benign Het
Me3 G T 7: 89,849,595 (GRCm38) G461V probably damaging Het
Mepce A G 5: 137,785,179 (GRCm38) L295P possibly damaging Het
Mtpap T A 18: 4,396,141 (GRCm38) Y478N probably damaging Het
Myl12a T C 17: 70,996,236 (GRCm38) M74V probably benign Het
Neil3 A T 8: 53,609,524 (GRCm38) M99K probably damaging Het
Nlrp3 A G 11: 59,551,790 (GRCm38) T723A possibly damaging Het
Obscn A T 11: 59,002,044 (GRCm38) I6792N probably benign Het
Olfr1043 A G 2: 86,162,922 (GRCm38) V9A possibly damaging Het
Olfr1100 G A 2: 86,978,157 (GRCm38) T213I probably benign Het
Olfr525 G T 7: 140,323,114 (GRCm38) W138C possibly damaging Het
Olfr715 A G 7: 107,129,315 (GRCm38) L26P probably benign Het
Olfr913 T A 9: 38,594,591 (GRCm38) Y123* probably null Het
Peg10 T TCCC 6: 4,756,451 (GRCm38) probably benign Het
Pitx2 C A 3: 129,218,858 (GRCm38) N312K probably damaging Het
Pot1b C A 17: 55,692,739 (GRCm38) V229L probably benign Het
Psmd1 A G 1: 86,078,607 (GRCm38) I232V possibly damaging Het
Rif1 A G 2: 52,110,923 (GRCm38) E1463G probably damaging Het
Scn5a T A 9: 119,539,538 (GRCm38) Y307F possibly damaging Het
Smtnl1 A T 2: 84,815,350 (GRCm38) Y392* probably null Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm38) probably benign Het
Sspo G A 6: 48,467,962 (GRCm38) G2268R probably benign Het
Tex47 G A 5: 7,305,301 (GRCm38) E161K probably benign Het
Tmem236 T C 2: 14,219,357 (GRCm38) L319P probably damaging Het
Tnk1 T C 11: 69,851,869 (GRCm38) T606A possibly damaging Het
Tnrc6a A G 7: 123,162,571 (GRCm38) T81A probably damaging Het
Trav6d-4 A T 14: 52,753,635 (GRCm38) T46S probably benign Het
Wdr19 T A 5: 65,223,867 (GRCm38) Y411* probably null Het
Zfp553 A G 7: 127,236,304 (GRCm38) T344A probably damaging Het
Zfp62 G A 11: 49,215,192 (GRCm38) G37S probably benign Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11,188,158 (GRCm38) missense probably damaging 1.00
IGL00583:Shprh APN 10 11,188,020 (GRCm38) missense probably benign 0.37
IGL00684:Shprh APN 10 11,163,037 (GRCm38) missense probably benign 0.11
IGL01295:Shprh APN 10 11,183,868 (GRCm38) missense probably damaging 0.96
IGL01387:Shprh APN 10 11,170,254 (GRCm38) missense probably damaging 1.00
IGL01635:Shprh APN 10 11,170,019 (GRCm38) nonsense probably null
IGL01833:Shprh APN 10 11,191,062 (GRCm38) missense probably damaging 1.00
IGL02013:Shprh APN 10 11,181,502 (GRCm38) splice site probably benign
IGL02502:Shprh APN 10 11,194,357 (GRCm38) missense possibly damaging 0.66
IGL02819:Shprh APN 10 11,154,765 (GRCm38) missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11,192,494 (GRCm38) frame shift probably null
R0010:Shprh UTSW 10 11,151,931 (GRCm38) missense probably benign
R0010:Shprh UTSW 10 11,151,931 (GRCm38) missense probably benign
R0053:Shprh UTSW 10 11,194,372 (GRCm38) splice site probably null
R0053:Shprh UTSW 10 11,194,372 (GRCm38) splice site probably null
R0255:Shprh UTSW 10 11,186,391 (GRCm38) missense possibly damaging 0.92
R0325:Shprh UTSW 10 11,170,109 (GRCm38) missense probably benign 0.00
R0331:Shprh UTSW 10 11,194,170 (GRCm38) splice site probably benign
R0494:Shprh UTSW 10 11,157,191 (GRCm38) missense probably damaging 1.00
R0532:Shprh UTSW 10 11,162,812 (GRCm38) missense possibly damaging 0.90
R0546:Shprh UTSW 10 11,183,887 (GRCm38) splice site probably benign
R0574:Shprh UTSW 10 11,163,077 (GRCm38) unclassified probably benign
R0605:Shprh UTSW 10 11,207,112 (GRCm38) missense probably damaging 1.00
R0662:Shprh UTSW 10 11,186,847 (GRCm38) missense probably damaging 1.00
R1148:Shprh UTSW 10 11,213,482 (GRCm38) missense possibly damaging 0.95
R1148:Shprh UTSW 10 11,213,482 (GRCm38) missense possibly damaging 0.95
R1263:Shprh UTSW 10 11,159,530 (GRCm38) missense probably damaging 1.00
R1588:Shprh UTSW 10 11,164,744 (GRCm38) missense probably damaging 1.00
R1638:Shprh UTSW 10 11,157,078 (GRCm38) missense probably benign
R1830:Shprh UTSW 10 11,186,911 (GRCm38) splice site probably null
R1898:Shprh UTSW 10 11,186,869 (GRCm38) missense probably damaging 1.00
R1903:Shprh UTSW 10 11,183,797 (GRCm38) nonsense probably null
R2060:Shprh UTSW 10 11,152,120 (GRCm38) missense probably benign 0.03
R2225:Shprh UTSW 10 11,162,235 (GRCm38) unclassified probably benign
R2363:Shprh UTSW 10 11,171,953 (GRCm38) missense probably damaging 1.00
R2509:Shprh UTSW 10 11,166,724 (GRCm38) missense probably damaging 1.00
R2891:Shprh UTSW 10 11,164,356 (GRCm38) missense probably damaging 1.00
R3077:Shprh UTSW 10 11,170,413 (GRCm38) missense probably damaging 1.00
R3150:Shprh UTSW 10 11,170,030 (GRCm38) missense probably damaging 0.97
R3796:Shprh UTSW 10 11,178,757 (GRCm38) missense possibly damaging 0.89
R4196:Shprh UTSW 10 11,207,860 (GRCm38) utr 3 prime probably benign
R4423:Shprh UTSW 10 11,186,518 (GRCm38) missense possibly damaging 0.82
R4488:Shprh UTSW 10 11,160,471 (GRCm38) missense probably benign 0.17
R4748:Shprh UTSW 10 11,170,476 (GRCm38) missense probably damaging 1.00
R4768:Shprh UTSW 10 11,181,540 (GRCm38) missense probably damaging 0.96
R4867:Shprh UTSW 10 11,164,557 (GRCm38) missense probably benign 0.00
R4937:Shprh UTSW 10 11,157,119 (GRCm38) missense probably benign
R5140:Shprh UTSW 10 11,154,705 (GRCm38) missense probably benign 0.03
R5318:Shprh UTSW 10 11,166,557 (GRCm38) missense probably benign 0.04
R5323:Shprh UTSW 10 11,170,297 (GRCm38) splice site probably null
R5450:Shprh UTSW 10 11,212,330 (GRCm38) missense possibly damaging 0.70
R5872:Shprh UTSW 10 11,188,073 (GRCm38) missense probably damaging 1.00
R6030:Shprh UTSW 10 11,151,991 (GRCm38) missense probably benign 0.37
R6030:Shprh UTSW 10 11,151,991 (GRCm38) missense probably benign 0.37
R6392:Shprh UTSW 10 11,178,741 (GRCm38) nonsense probably null
R6416:Shprh UTSW 10 11,167,873 (GRCm38) missense probably damaging 1.00
R6470:Shprh UTSW 10 11,171,937 (GRCm38) missense probably damaging 0.98
R6513:Shprh UTSW 10 11,186,893 (GRCm38) missense probably damaging 1.00
R6530:Shprh UTSW 10 11,194,267 (GRCm38) missense probably benign 0.02
R6678:Shprh UTSW 10 11,166,545 (GRCm38) missense probably benign 0.16
R6757:Shprh UTSW 10 11,181,508 (GRCm38) splice site probably null
R6971:Shprh UTSW 10 11,166,693 (GRCm38) missense probably damaging 1.00
R7158:Shprh UTSW 10 11,166,730 (GRCm38) missense probably damaging 0.98
R7582:Shprh UTSW 10 11,164,705 (GRCm38) missense probably benign
R7757:Shprh UTSW 10 11,162,180 (GRCm38) missense probably benign 0.30
R7812:Shprh UTSW 10 11,151,991 (GRCm38) missense probably benign
R7998:Shprh UTSW 10 11,185,341 (GRCm38) missense probably damaging 1.00
R8061:Shprh UTSW 10 11,212,333 (GRCm38) missense possibly damaging 0.71
R8082:Shprh UTSW 10 11,151,811 (GRCm38) missense probably benign 0.22
R8116:Shprh UTSW 10 11,213,461 (GRCm38) missense probably damaging 0.99
R8445:Shprh UTSW 10 11,181,569 (GRCm38) missense possibly damaging 0.92
R8530:Shprh UTSW 10 11,151,934 (GRCm38) missense probably benign 0.37
R8759:Shprh UTSW 10 11,157,164 (GRCm38) missense possibly damaging 0.92
R8937:Shprh UTSW 10 11,185,437 (GRCm38) missense possibly damaging 0.60
R8995:Shprh UTSW 10 11,164,830 (GRCm38) nonsense probably null
R9053:Shprh UTSW 10 11,154,702 (GRCm38) missense probably benign 0.04
R9131:Shprh UTSW 10 11,162,845 (GRCm38) missense possibly damaging 0.58
R9176:Shprh UTSW 10 11,160,576 (GRCm38) missense probably benign 0.02
R9391:Shprh UTSW 10 11,162,889 (GRCm38) missense probably benign 0.05
R9423:Shprh UTSW 10 11,205,263 (GRCm38) missense probably damaging 1.00
R9563:Shprh UTSW 10 11,166,491 (GRCm38) nonsense probably null
R9668:Shprh UTSW 10 11,206,332 (GRCm38) missense probably damaging 0.97
R9709:Shprh UTSW 10 11,162,830 (GRCm38) missense possibly damaging 0.91
R9718:Shprh UTSW 10 11,213,504 (GRCm38) missense probably damaging 1.00
R9750:Shprh UTSW 10 11,164,460 (GRCm38) missense probably damaging 0.98
RF012:Shprh UTSW 10 11,164,841 (GRCm38) missense probably benign 0.02
V8831:Shprh UTSW 10 11,186,862 (GRCm38) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,186,447 (GRCm38) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,164,553 (GRCm38) missense probably benign
Z1177:Shprh UTSW 10 11,151,762 (GRCm38) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TGGAAGTACAAGACAGTTTTCAGG -3'
(R):5'- ATATTCCTTCTTCCATGCCTCAAAGAG -3'

Sequencing Primer
(F):5'- TTTCAGGGACCTACAAATGCTC -3'
(R):5'- TTCCATGCCTCAAAGAGATCCATTG -3'
Posted On 2020-09-02