Incidental Mutation 'R8390:Nlrp3'
ID 647341
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene Name NLR family, pyrin domain containing 3
Synonyms Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
MMRRC Submission 067755-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R8390 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 59432395-59457781 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59442616 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 723 (T723A)
Ref Sequence ENSEMBL: ENSMUSP00000078440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]
AlphaFold Q8R4B8
Predicted Effect possibly damaging
Transcript: ENSMUST00000079476
AA Change: T723A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: T723A

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101148
AA Change: T723A

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: T723A

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149126
SMART Domains Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
Pfam:FISNA 135 173 1.6e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,830,841 (GRCm39) F50I unknown Het
Abca9 A T 11: 110,036,456 (GRCm39) M551K probably benign Het
Adgrl3 T C 5: 81,914,057 (GRCm39) S1145P probably damaging Het
Brix1 C T 15: 10,485,954 (GRCm39) R9H probably benign Het
C1d T C 11: 17,213,993 (GRCm39) V83A probably damaging Het
Ciz1 G T 2: 32,257,335 (GRCm39) V127L probably benign Het
Csnk1g3 A T 18: 54,081,150 (GRCm39) T374S probably benign Het
Elavl1 T A 8: 4,339,623 (GRCm39) K320* probably null Het
Foxn3 T A 12: 99,355,000 (GRCm39) M55L probably benign Het
Gm14399 A T 2: 174,972,605 (GRCm39) Y383* probably null Het
H2-M10.5 T A 17: 37,085,487 (GRCm39) H215Q probably benign Het
Hsd17b13 C A 5: 104,120,512 (GRCm39) C80F probably damaging Het
Ifi206 G T 1: 173,308,511 (GRCm39) T495N Het
Ifi207 GTT GT 1: 173,557,016 (GRCm39) probably null Het
Ipo13 A T 4: 117,769,534 (GRCm39) I86N probably damaging Het
Iqcf3 T G 9: 106,438,175 (GRCm39) E16A unknown Het
Kcnh5 T A 12: 75,134,532 (GRCm39) D339V probably damaging Het
Lmbr1 C T 5: 29,440,040 (GRCm39) M441I probably benign Het
Me3 G T 7: 89,498,803 (GRCm39) G461V probably damaging Het
Mepce A G 5: 137,783,441 (GRCm39) L295P possibly damaging Het
Mtpap T A 18: 4,396,141 (GRCm39) Y478N probably damaging Het
Myl12a T C 17: 71,303,231 (GRCm39) M74V probably benign Het
Neil3 A T 8: 54,062,559 (GRCm39) M99K probably damaging Het
Obscn A T 11: 58,892,870 (GRCm39) I6792N probably benign Het
Or13a19 G T 7: 139,903,027 (GRCm39) W138C possibly damaging Het
Or2d2 A G 7: 106,728,522 (GRCm39) L26P probably benign Het
Or5al7 A G 2: 85,993,266 (GRCm39) V9A possibly damaging Het
Or8b49 T A 9: 38,505,887 (GRCm39) Y123* probably null Het
Or8h10 G A 2: 86,808,501 (GRCm39) T213I probably benign Het
Peg10 T TCCC 6: 4,756,451 (GRCm39) probably benign Het
Pitx2 C A 3: 129,012,507 (GRCm39) N312K probably damaging Het
Pot1b C A 17: 55,999,739 (GRCm39) V229L probably benign Het
Psmd1 A G 1: 86,006,329 (GRCm39) I232V possibly damaging Het
Rif1 A G 2: 52,000,935 (GRCm39) E1463G probably damaging Het
Scn5a T A 9: 119,368,604 (GRCm39) Y307F possibly damaging Het
Shprh G A 10: 11,063,727 (GRCm39) E1267K possibly damaging Het
Smtnl1 A T 2: 84,645,694 (GRCm39) Y392* probably null Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Sspo G A 6: 48,444,896 (GRCm39) G2268R probably benign Het
Tex47 G A 5: 7,355,301 (GRCm39) E161K probably benign Het
Timd6 G T 11: 46,468,082 (GRCm39) R52L probably damaging Het
Tmem236 T C 2: 14,224,168 (GRCm39) L319P probably damaging Het
Tnk1 T C 11: 69,742,695 (GRCm39) T606A possibly damaging Het
Tnrc6a A G 7: 122,761,794 (GRCm39) T81A probably damaging Het
Trav6d-4 A T 14: 52,991,092 (GRCm39) T46S probably benign Het
Wdr19 T A 5: 65,381,210 (GRCm39) Y411* probably null Het
Zfp553 A G 7: 126,835,476 (GRCm39) T344A probably damaging Het
Zfp62 G A 11: 49,106,019 (GRCm39) G37S probably benign Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59,456,769 (GRCm39) missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59,455,942 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59,442,713 (GRCm39) missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59,440,204 (GRCm39) missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59,440,361 (GRCm39) missense probably benign
IGL02334:Nlrp3 APN 11 59,455,909 (GRCm39) missense probably benign
IGL02417:Nlrp3 APN 11 59,456,849 (GRCm39) unclassified probably benign
IGL02578:Nlrp3 APN 11 59,439,227 (GRCm39) missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59,456,802 (GRCm39) missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59,446,608 (GRCm39) missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59,440,372 (GRCm39) missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59,439,842 (GRCm39) missense probably damaging 1.00
Flogiston UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
nd1 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
Nd14 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd3 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
nd5 UTSW 11 59,456,705 (GRCm39) missense probably benign 0.01
nd6 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
nd7 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd9 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
Park2 UTSW 11 59,455,954 (GRCm39) nonsense probably null
Park3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
Park4 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
Park5 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
Park6 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
Park7 UTSW 11 59,438,836 (GRCm39) nonsense probably null
Park8 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59,455,954 (GRCm39) nonsense probably null
R0362:Nlrp3 UTSW 11 59,439,623 (GRCm39) missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59,446,750 (GRCm39) splice site probably benign
R0649:Nlrp3 UTSW 11 59,439,368 (GRCm39) missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59,439,082 (GRCm39) missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59,446,594 (GRCm39) missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59,433,949 (GRCm39) missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59,434,177 (GRCm39) missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59,449,228 (GRCm39) missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59,439,742 (GRCm39) missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59,439,962 (GRCm39) missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59,440,487 (GRCm39) missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59,438,836 (GRCm39) nonsense probably null
R4540:Nlrp3 UTSW 11 59,442,725 (GRCm39) missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59,440,048 (GRCm39) missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59,439,127 (GRCm39) missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59,440,064 (GRCm39) missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59,455,910 (GRCm39) missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59,439,889 (GRCm39) missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59,446,574 (GRCm39) nonsense probably null
R5869:Nlrp3 UTSW 11 59,438,960 (GRCm39) missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59,437,678 (GRCm39) missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59,437,617 (GRCm39) missense probably benign
R5979:Nlrp3 UTSW 11 59,439,797 (GRCm39) missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59,439,392 (GRCm39) missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59,456,018 (GRCm39) missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59,439,272 (GRCm39) missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59,438,912 (GRCm39) missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59,455,892 (GRCm39) missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59,433,829 (GRCm39) splice site probably null
R7916:Nlrp3 UTSW 11 59,442,689 (GRCm39) missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59,439,614 (GRCm39) missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59,440,229 (GRCm39) missense probably benign 0.02
R8550:Nlrp3 UTSW 11 59,440,097 (GRCm39) missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59,440,216 (GRCm39) missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59,455,870 (GRCm39) missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59,439,584 (GRCm39) missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59,434,141 (GRCm39) missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59,440,148 (GRCm39) missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
RF040:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
Z1088:Nlrp3 UTSW 11 59,442,686 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TAAGCTGCAAACAGGCCAGG -3'
(R):5'- GAAGCGATATTCTCCCAAACGC -3'

Sequencing Primer
(F):5'- CCAGGGAAACAACGGTGTGAC -3'
(R):5'- AACGCTTACTTCTTAGTTCATTGGG -3'
Posted On 2020-09-02