Incidental Mutation 'R8390:H2-M10.5'
ID647348
Institutional Source Beutler Lab
Gene Symbol H2-M10.5
Ensembl Gene ENSMUSG00000037246
Gene Namehistocompatibility 2, M region locus 10.5
Synonyms6.9H
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R8390 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location36772910-36776234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36774595 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 215 (H215Q)
Ref Sequence ENSEMBL: ENSMUSP00000047766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041531]
Predicted Effect probably benign
Transcript: ENSMUST00000041531
AA Change: H215Q

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000047766
Gene: ENSMUSG00000037246
AA Change: H215Q

DomainStartEndE-ValueType
Pfam:MHC_I 24 202 8.6e-44 PFAM
IGc1 221 292 5.56e-20 SMART
transmembrane domain 305 327 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,692,780 F50I unknown Het
Abca9 A T 11: 110,145,630 M551K probably benign Het
Adgrl3 T C 5: 81,766,210 S1145P probably damaging Het
BC053393 G T 11: 46,577,255 R52L probably damaging Het
Brix1 C T 15: 10,485,868 R9H probably benign Het
C1d T C 11: 17,263,993 V83A probably damaging Het
Ciz1 G T 2: 32,367,323 V127L probably benign Het
Csnk1g3 A T 18: 53,948,078 T374S probably benign Het
Elavl1 T A 8: 4,289,623 K320* probably null Het
Foxn3 T A 12: 99,388,741 M55L probably benign Het
Gm14399 A T 2: 175,130,812 Y383* probably null Het
Hsd17b13 C A 5: 103,972,646 C80F probably damaging Het
Ifi206 G T 1: 173,480,945 T495N Het
Ifi207 GTT GT 1: 173,729,450 probably null Het
Ipo13 A T 4: 117,912,337 I86N probably damaging Het
Iqcf3 T G 9: 106,560,976 E16A unknown Het
Kcnh5 T A 12: 75,087,758 D339V probably damaging Het
Lmbr1 C T 5: 29,235,042 M441I probably benign Het
Me3 G T 7: 89,849,595 G461V probably damaging Het
Mepce A G 5: 137,785,179 L295P possibly damaging Het
Mtpap T A 18: 4,396,141 Y478N probably damaging Het
Myl12a T C 17: 70,996,236 M74V probably benign Het
Neil3 A T 8: 53,609,524 M99K probably damaging Het
Nlrp3 A G 11: 59,551,790 T723A possibly damaging Het
Obscn A T 11: 59,002,044 I6792N probably benign Het
Olfr1043 A G 2: 86,162,922 V9A possibly damaging Het
Olfr1100 G A 2: 86,978,157 T213I probably benign Het
Olfr525 G T 7: 140,323,114 W138C possibly damaging Het
Olfr715 A G 7: 107,129,315 L26P probably benign Het
Olfr913 T A 9: 38,594,591 Y123* probably null Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pitx2 C A 3: 129,218,858 N312K probably damaging Het
Pot1b C A 17: 55,692,739 V229L probably benign Het
Psmd1 A G 1: 86,078,607 I232V possibly damaging Het
Rif1 A G 2: 52,110,923 E1463G probably damaging Het
Scn5a T A 9: 119,539,538 Y307F possibly damaging Het
Shprh G A 10: 11,187,983 E1267K possibly damaging Het
Smtnl1 A T 2: 84,815,350 Y392* probably null Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Sspo G A 6: 48,467,962 G2268R probably benign Het
Tex47 G A 5: 7,305,301 E161K probably benign Het
Tmem236 T C 2: 14,219,357 L319P probably damaging Het
Tnk1 T C 11: 69,851,869 T606A possibly damaging Het
Tnrc6a A G 7: 123,162,571 T81A probably damaging Het
Trav6d-4 A T 14: 52,753,635 T46S probably benign Het
Wdr19 T A 5: 65,223,867 Y411* probably null Het
Zfp553 A G 7: 127,236,304 T344A probably damaging Het
Zfp62 G A 11: 49,215,192 G37S probably benign Het
Other mutations in H2-M10.5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:H2-M10.5 APN 17 36773335 missense possibly damaging 0.86
IGL01562:H2-M10.5 APN 17 36773776 missense possibly damaging 0.53
IGL01878:H2-M10.5 APN 17 36773816 missense probably damaging 1.00
IGL03271:H2-M10.5 APN 17 36773351 missense possibly damaging 0.86
IGL03377:H2-M10.5 APN 17 36773485 missense probably benign 0.11
R0555:H2-M10.5 UTSW 17 36774728 missense probably damaging 1.00
R1556:H2-M10.5 UTSW 17 36773313 missense probably damaging 1.00
R1815:H2-M10.5 UTSW 17 36773944 missense probably damaging 1.00
R1913:H2-M10.5 UTSW 17 36774768 missense probably damaging 1.00
R2420:H2-M10.5 UTSW 17 36774999 missense probably benign 0.23
R2421:H2-M10.5 UTSW 17 36774999 missense probably benign 0.23
R2422:H2-M10.5 UTSW 17 36774999 missense probably benign 0.23
R5668:H2-M10.5 UTSW 17 36774581 missense probably damaging 0.99
R7694:H2-M10.5 UTSW 17 36773749 missense probably damaging 1.00
R8441:H2-M10.5 UTSW 17 36773307 missense probably benign 0.14
R8497:H2-M10.5 UTSW 17 36773837 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGATCCTGAGTGTAGGCTTC -3'
(R):5'- TCAGGTAACCCTTTATGGTGC -3'

Sequencing Primer
(F):5'- GCTTCTGTGTGGACTCTGCTC -3'
(R):5'- GGTAACCCTTTATGGTGCACATGAC -3'
Posted On2020-09-02