Incidental Mutation 'R8391:Plppr4'
ID647365
Institutional Source Beutler Lab
Gene Symbol Plppr4
Ensembl Gene ENSMUSG00000044667
Gene Namephospholipid phosphatase related 4
SynonymsLppr4, D3Bwg0562e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8391 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location117319139-117360876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 117335411 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 136 (I136V)
Ref Sequence ENSEMBL: ENSMUSP00000052306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061071] [ENSMUST00000197743]
Predicted Effect probably benign
Transcript: ENSMUST00000061071
AA Change: I136V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000052306
Gene: ENSMUSG00000044667
AA Change: I136V

DomainStartEndE-ValueType
acidPPc 180 324 4.07e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197743
AA Change: I136V

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143753
Gene: ENSMUSG00000044667
AA Change: I136V

DomainStartEndE-ValueType
SCOP:d1d2ta_ 59 268 1e-7 SMART
Blast:acidPPc 180 265 8e-53 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the lipid phosphate phosphatase (LPP) family. LPPs catalyze the dephosphorylation of a number of bioactive lipid mediators that regulate a variety of cell functions. This protein is specifically expressed in neurons. It is located in the membranes of outgrowing axons and has been shown to be important for axonal outgrowth during development and regenerative sprouting. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, seizures, hyperexcitability of evoked fEPSP, and premature lethality around 3 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,932,668 W616R probably damaging Het
Abcf3 T C 16: 20,550,218 S155P possibly damaging Het
Akr1c21 C T 13: 4,576,279 R101W probably damaging Het
Angpt1 T A 15: 42,512,398 N154I probably damaging Het
Atp2a1 T A 7: 126,448,716 I641F possibly damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cacna1b G A 2: 24,706,200 A493V probably damaging Het
Cacna1h G A 17: 25,377,230 A1939V probably benign Het
Cacna2d4 A G 6: 119,348,745 I1027V probably benign Het
Cbln3 G A 14: 55,883,066 R170C probably damaging Het
Cemip T C 7: 83,955,309 S842G probably damaging Het
Cep164 T A 9: 45,807,193 Q284L unknown Het
Crybg2 T C 4: 134,075,724 F889L probably damaging Het
Fam160a1 T C 3: 85,688,481 N366D probably damaging Het
Gars T A 6: 55,048,142 Y124N probably damaging Het
Gbp2b T C 3: 142,604,133 F228S probably damaging Het
Gm5565 C A 5: 146,160,152 R59L probably benign Het
Gm8947 A T 1: 151,192,986 D190V probably benign Het
Grid2ip T C 5: 143,380,196 M543T probably damaging Het
Gucy2c A G 6: 136,704,215 L957P probably damaging Het
Hint1 T C 11: 54,866,542 I18T possibly damaging Het
Il23r T C 6: 67,452,390 S323G probably benign Het
Iqcf3 T G 9: 106,560,976 E16A unknown Het
Kcnj1 A T 9: 32,396,732 T151S probably damaging Het
Kdm1a G T 4: 136,553,843 T685K probably benign Het
Lipo4 T A 19: 33,511,565 H206L probably benign Het
Lrp5 A G 19: 3,604,185 Y1081H probably damaging Het
Masp1 A T 16: 23,470,378 H557Q possibly damaging Het
Nhsl1 C T 10: 18,524,943 T605I possibly damaging Het
Olfr366 T A 2: 37,220,265 Y259N probably damaging Het
Olfr50 C T 2: 36,794,084 P283S probably damaging Het
Pkmyt1 C T 17: 23,735,039 R307C probably damaging Het
Ppp1r12c A C 7: 4,497,432 Y150D probably damaging Het
Qrich2 C G 11: 116,465,577 V149L probably benign Het
R3hdm1 T C 1: 128,193,478 F176L Het
Ric8a T A 7: 140,858,003 S52T probably benign Het
Romo1 G T 2: 156,144,420 probably benign Het
Rps6ka1 G A 4: 133,864,035 H318Y probably damaging Het
Slc43a3 A G 2: 84,937,807 N41S probably benign Het
Srrm4 T G 5: 116,444,696 T567P unknown Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
St6galnac4 G T 2: 32,594,074 D95Y probably damaging Het
Sult2a6 T C 7: 14,222,591 probably null Het
Synj2 A G 17: 5,941,521 E24G probably damaging Het
Try10 T G 6: 41,357,372 L166R probably damaging Het
Ttn A G 2: 76,732,200 V28767A probably damaging Het
Ttn T A 2: 76,774,478 I18371F probably damaging Het
Uhrf1bp1l T C 10: 89,809,743 V1226A possibly damaging Het
Zc3h13 T A 14: 75,331,185 L1306Q probably damaging Het
Zp2 T A 7: 120,126,956 T674S probably benign Het
Zscan4-ps3 A G 7: 11,612,874 Y279C probably benign Het
Other mutations in Plppr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Plppr4 APN 3 117322220 missense probably benign 0.01
IGL01969:Plppr4 APN 3 117328359 missense probably damaging 1.00
IGL02014:Plppr4 APN 3 117335573 missense probably damaging 1.00
IGL02068:Plppr4 APN 3 117331784 splice site probably benign
IGL02426:Plppr4 APN 3 117322295 missense probably benign 0.01
IGL03203:Plppr4 APN 3 117325891 missense possibly damaging 0.89
PIT4445001:Plppr4 UTSW 3 117360308 unclassified probably benign
R0376:Plppr4 UTSW 3 117323091 missense probably benign 0.05
R0755:Plppr4 UTSW 3 117322670 missense possibly damaging 0.68
R0831:Plppr4 UTSW 3 117331646 critical splice donor site probably null
R1518:Plppr4 UTSW 3 117335503 missense probably damaging 1.00
R1523:Plppr4 UTSW 3 117322841 missense probably damaging 1.00
R1581:Plppr4 UTSW 3 117328266 missense possibly damaging 0.58
R1628:Plppr4 UTSW 3 117328272 missense probably damaging 1.00
R2510:Plppr4 UTSW 3 117331706 missense probably damaging 0.99
R2511:Plppr4 UTSW 3 117331706 missense probably damaging 0.99
R4332:Plppr4 UTSW 3 117322825 missense probably benign
R4380:Plppr4 UTSW 3 117322397 missense probably benign 0.40
R4787:Plppr4 UTSW 3 117322330 missense probably damaging 0.99
R4829:Plppr4 UTSW 3 117335591 missense possibly damaging 0.94
R5511:Plppr4 UTSW 3 117325902 missense probably benign 0.39
R5819:Plppr4 UTSW 3 117325864 missense possibly damaging 0.89
R6149:Plppr4 UTSW 3 117322394 missense probably benign 0.22
R6257:Plppr4 UTSW 3 117322579 missense possibly damaging 0.49
R6974:Plppr4 UTSW 3 117323018 missense probably damaging 1.00
R7045:Plppr4 UTSW 3 117360034 missense probably damaging 1.00
R7102:Plppr4 UTSW 3 117323183 missense probably damaging 0.98
R7507:Plppr4 UTSW 3 117322105 missense possibly damaging 0.76
R7820:Plppr4 UTSW 3 117321949 missense possibly damaging 0.88
R8179:Plppr4 UTSW 3 117331678 missense probably damaging 1.00
R8181:Plppr4 UTSW 3 117322465 missense probably damaging 1.00
R8531:Plppr4 UTSW 3 117321943 missense probably damaging 1.00
R8762:Plppr4 UTSW 3 117325833 missense probably damaging 1.00
R8784:Plppr4 UTSW 3 117322541 nonsense probably null
R8933:Plppr4 UTSW 3 117323041 missense probably damaging 1.00
Z1176:Plppr4 UTSW 3 117322849 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTCACAATCAGCATAAAGTG -3'
(R):5'- GGCATCATCAGTGGTTAGCCTC -3'

Sequencing Primer
(F):5'- CACAATCAGCATAAAGTGTTACTAGG -3'
(R):5'- AGTGGTTAGCCTCTACTTCTTGGAAC -3'
Posted On2020-09-02