Incidental Mutation 'R8391:1600015I10Rik'
ID 647375
Institutional Source Beutler Lab
Gene Symbol 1600015I10Rik
Ensembl Gene ENSMUSG00000029813
Gene Name RIKEN cDNA 1600015I10 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock # R8391 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 48929895-48933687 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 48932668 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 616 (W616R)
Ref Sequence ENSEMBL: ENSMUSP00000031837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031837]
AlphaFold E9Q745
Predicted Effect probably damaging
Transcript: ENSMUST00000031837
AA Change: W616R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031837
Gene: ENSMUSG00000029813
AA Change: W616R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 50 136 1.7e-25 PFAM
Pfam:Cu_amine_oxidN3 152 252 3.5e-16 PFAM
Pfam:Cu_amine_oxid 306 708 7.1e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,550,218 S155P possibly damaging Het
Akr1c21 C T 13: 4,576,279 R101W probably damaging Het
Angpt1 T A 15: 42,512,398 N154I probably damaging Het
Atp2a1 T A 7: 126,448,716 I641F possibly damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cacna1b G A 2: 24,706,200 A493V probably damaging Het
Cacna1h G A 17: 25,377,230 A1939V probably benign Het
Cacna2d4 A G 6: 119,348,745 I1027V probably benign Het
Cbln3 G A 14: 55,883,066 R170C probably damaging Het
Cemip T C 7: 83,955,309 S842G probably damaging Het
Cep164 T A 9: 45,807,193 Q284L unknown Het
Crybg2 T C 4: 134,075,724 F889L probably damaging Het
Fam160a1 T C 3: 85,688,481 N366D probably damaging Het
Gars T A 6: 55,048,142 Y124N probably damaging Het
Gbp2b T C 3: 142,604,133 F228S probably damaging Het
Gm5565 C A 5: 146,160,152 R59L probably benign Het
Gm8947 A T 1: 151,192,986 D190V probably benign Het
Grid2ip T C 5: 143,380,196 M543T probably damaging Het
Gucy2c A G 6: 136,704,215 L957P probably damaging Het
Hint1 T C 11: 54,866,542 I18T possibly damaging Het
Il23r T C 6: 67,452,390 S323G probably benign Het
Iqcf3 T G 9: 106,560,976 E16A unknown Het
Kcnj1 A T 9: 32,396,732 T151S probably damaging Het
Kdm1a G T 4: 136,553,843 T685K probably benign Het
Lipo4 T A 19: 33,511,565 H206L probably benign Het
Lrp5 A G 19: 3,604,185 Y1081H probably damaging Het
Masp1 A T 16: 23,470,378 H557Q possibly damaging Het
Nhsl1 C T 10: 18,524,943 T605I possibly damaging Het
Olfr366 T A 2: 37,220,265 Y259N probably damaging Het
Olfr50 C T 2: 36,794,084 P283S probably damaging Het
Pkmyt1 C T 17: 23,735,039 R307C probably damaging Het
Plppr4 T C 3: 117,335,411 I136V probably benign Het
Ppp1r12c A C 7: 4,497,432 Y150D probably damaging Het
Qrich2 C G 11: 116,465,577 V149L probably benign Het
R3hdm1 T C 1: 128,193,478 F176L Het
Ric8a T A 7: 140,858,003 S52T probably benign Het
Romo1 G T 2: 156,144,420 probably benign Het
Rps6ka1 G A 4: 133,864,035 H318Y probably damaging Het
Slc43a3 A G 2: 84,937,807 N41S probably benign Het
Srrm4 T G 5: 116,444,696 T567P unknown Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
St6galnac4 G T 2: 32,594,074 D95Y probably damaging Het
Sult2a6 T C 7: 14,222,591 probably null Het
Synj2 A G 17: 5,941,521 E24G probably damaging Het
Try10 T G 6: 41,357,372 L166R probably damaging Het
Ttn A G 2: 76,732,200 V28767A probably damaging Het
Ttn T A 2: 76,774,478 I18371F probably damaging Het
Uhrf1bp1l T C 10: 89,809,743 V1226A possibly damaging Het
Zc3h13 T A 14: 75,331,185 L1306Q probably damaging Het
Zp2 T A 7: 120,126,956 T674S probably benign Het
Zscan4-ps3 A G 7: 11,612,874 Y279C probably benign Het
Other mutations in 1600015I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:1600015I10Rik APN 6 48931040 missense probably damaging 1.00
IGL01347:1600015I10Rik APN 6 48932543 missense probably benign 0.02
IGL01751:1600015I10Rik APN 6 48930588 missense possibly damaging 0.79
IGL01915:1600015I10Rik APN 6 48931648 missense probably damaging 1.00
IGL02669:1600015I10Rik APN 6 48931473 missense probably damaging 1.00
IGL03033:1600015I10Rik APN 6 48932518 missense probably benign 0.00
IGL03242:1600015I10Rik APN 6 48932545 missense possibly damaging 0.68
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0448:1600015I10Rik UTSW 6 48933057 missense probably damaging 1.00
R1488:1600015I10Rik UTSW 6 48933447 missense possibly damaging 0.91
R1498:1600015I10Rik UTSW 6 48931371 missense probably benign 0.00
R1520:1600015I10Rik UTSW 6 48931297 nonsense probably null
R1922:1600015I10Rik UTSW 6 48931286 missense probably benign 0.00
R1992:1600015I10Rik UTSW 6 48930769 missense probably damaging 1.00
R1997:1600015I10Rik UTSW 6 48932429 missense probably damaging 0.98
R2021:1600015I10Rik UTSW 6 48931451 missense probably damaging 1.00
R3771:1600015I10Rik UTSW 6 48931196 missense probably damaging 1.00
R4208:1600015I10Rik UTSW 6 48931647 missense probably damaging 1.00
R4790:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5114:1600015I10Rik UTSW 6 48931358 missense probably benign 0.02
R5610:1600015I10Rik UTSW 6 48931019 missense probably benign 0.00
R5823:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5847:1600015I10Rik UTSW 6 48933478 missense probably damaging 1.00
R6233:1600015I10Rik UTSW 6 48930965 missense probably benign
R6357:1600015I10Rik UTSW 6 48930974 missense probably benign 0.00
R6694:1600015I10Rik UTSW 6 48930546 missense probably benign 0.21
R6733:1600015I10Rik UTSW 6 48930530 missense probably damaging 1.00
R6894:1600015I10Rik UTSW 6 48930662 missense probably damaging 1.00
R6898:1600015I10Rik UTSW 6 48931041 missense probably damaging 0.97
R6916:1600015I10Rik UTSW 6 48931053 missense probably benign 0.01
R7242:1600015I10Rik UTSW 6 48931128 missense probably damaging 1.00
R7762:1600015I10Rik UTSW 6 48932686 missense probably benign 0.07
R8257:1600015I10Rik UTSW 6 48932497 missense probably benign 0.04
R8839:1600015I10Rik UTSW 6 48931040 missense probably damaging 1.00
R8863:1600015I10Rik UTSW 6 48930108 missense probably benign 0.00
R9266:1600015I10Rik UTSW 6 48930237 missense probably benign 0.00
R9274:1600015I10Rik UTSW 6 48930407 missense possibly damaging 0.94
R9380:1600015I10Rik UTSW 6 48933130 missense probably damaging 1.00
R9382:1600015I10Rik UTSW 6 48930364 missense probably benign 0.08
X0062:1600015I10Rik UTSW 6 48933132 missense possibly damaging 0.55
Z1176:1600015I10Rik UTSW 6 48932468 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGACATCAGGCACTTGGAAATACC -3'
(R):5'- GAAAATTGCCCATCGCCCTC -3'

Sequencing Primer
(F):5'- GGCACTTGGAAATACCCTAAAG -3'
(R):5'- GGCAGGATCTCTGTATGCATTTCC -3'
Posted On 2020-09-02