Incidental Mutation 'R8391:1600015I10Rik'
ID647375
Institutional Source Beutler Lab
Gene Symbol 1600015I10Rik
Ensembl Gene ENSMUSG00000029813
Gene NameRIKEN cDNA 1600015I10 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R8391 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location48929895-48933687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 48932668 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 616 (W616R)
Ref Sequence ENSEMBL: ENSMUSP00000031837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031837]
Predicted Effect probably damaging
Transcript: ENSMUST00000031837
AA Change: W616R

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031837
Gene: ENSMUSG00000029813
AA Change: W616R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 50 136 1.7e-25 PFAM
Pfam:Cu_amine_oxidN3 152 252 3.5e-16 PFAM
Pfam:Cu_amine_oxid 306 708 7.1e-94 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 T C 16: 20,550,218 S155P possibly damaging Het
Akr1c21 C T 13: 4,576,279 R101W probably damaging Het
Angpt1 T A 15: 42,512,398 N154I probably damaging Het
Atp2a1 T A 7: 126,448,716 I641F possibly damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cacna1b G A 2: 24,706,200 A493V probably damaging Het
Cacna1h G A 17: 25,377,230 A1939V probably benign Het
Cacna2d4 A G 6: 119,348,745 I1027V probably benign Het
Cbln3 G A 14: 55,883,066 R170C probably damaging Het
Cemip T C 7: 83,955,309 S842G probably damaging Het
Cep164 T A 9: 45,807,193 Q284L unknown Het
Crybg2 T C 4: 134,075,724 F889L probably damaging Het
Fam160a1 T C 3: 85,688,481 N366D probably damaging Het
Gars T A 6: 55,048,142 Y124N probably damaging Het
Gbp2b T C 3: 142,604,133 F228S probably damaging Het
Gm5565 C A 5: 146,160,152 R59L probably benign Het
Gm8947 A T 1: 151,192,986 D190V probably benign Het
Grid2ip T C 5: 143,380,196 M543T probably damaging Het
Gucy2c A G 6: 136,704,215 L957P probably damaging Het
Hint1 T C 11: 54,866,542 I18T possibly damaging Het
Il23r T C 6: 67,452,390 S323G probably benign Het
Iqcf3 T G 9: 106,560,976 E16A unknown Het
Kcnj1 A T 9: 32,396,732 T151S probably damaging Het
Kdm1a G T 4: 136,553,843 T685K probably benign Het
Lipo4 T A 19: 33,511,565 H206L probably benign Het
Lrp5 A G 19: 3,604,185 Y1081H probably damaging Het
Masp1 A T 16: 23,470,378 H557Q possibly damaging Het
Nhsl1 C T 10: 18,524,943 T605I possibly damaging Het
Olfr366 T A 2: 37,220,265 Y259N probably damaging Het
Olfr50 C T 2: 36,794,084 P283S probably damaging Het
Pkmyt1 C T 17: 23,735,039 R307C probably damaging Het
Plppr4 T C 3: 117,335,411 I136V probably benign Het
Ppp1r12c A C 7: 4,497,432 Y150D probably damaging Het
Qrich2 C G 11: 116,465,577 V149L probably benign Het
R3hdm1 T C 1: 128,193,478 F176L Het
Ric8a T A 7: 140,858,003 S52T probably benign Het
Romo1 G T 2: 156,144,420 probably benign Het
Rps6ka1 G A 4: 133,864,035 H318Y probably damaging Het
Slc43a3 A G 2: 84,937,807 N41S probably benign Het
Srrm4 T G 5: 116,444,696 T567P unknown Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
St6galnac4 G T 2: 32,594,074 D95Y probably damaging Het
Sult2a6 T C 7: 14,222,591 probably null Het
Synj2 A G 17: 5,941,521 E24G probably damaging Het
Try10 T G 6: 41,357,372 L166R probably damaging Het
Ttn A G 2: 76,732,200 V28767A probably damaging Het
Ttn T A 2: 76,774,478 I18371F probably damaging Het
Uhrf1bp1l T C 10: 89,809,743 V1226A possibly damaging Het
Zc3h13 T A 14: 75,331,185 L1306Q probably damaging Het
Zp2 T A 7: 120,126,956 T674S probably benign Het
Zscan4-ps3 A G 7: 11,612,874 Y279C probably benign Het
Other mutations in 1600015I10Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:1600015I10Rik APN 6 48931040 missense probably damaging 1.00
IGL01347:1600015I10Rik APN 6 48932543 missense probably benign 0.02
IGL01751:1600015I10Rik APN 6 48930588 missense possibly damaging 0.79
IGL01915:1600015I10Rik APN 6 48931648 missense probably damaging 1.00
IGL02669:1600015I10Rik APN 6 48931473 missense probably damaging 1.00
IGL03033:1600015I10Rik APN 6 48932518 missense probably benign 0.00
IGL03242:1600015I10Rik APN 6 48932545 missense possibly damaging 0.68
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0096:1600015I10Rik UTSW 6 48931188 missense probably damaging 1.00
R0448:1600015I10Rik UTSW 6 48933057 missense probably damaging 1.00
R1488:1600015I10Rik UTSW 6 48933447 missense possibly damaging 0.91
R1498:1600015I10Rik UTSW 6 48931371 missense probably benign 0.00
R1520:1600015I10Rik UTSW 6 48931297 nonsense probably null
R1922:1600015I10Rik UTSW 6 48931286 missense probably benign 0.00
R1992:1600015I10Rik UTSW 6 48930769 missense probably damaging 1.00
R1997:1600015I10Rik UTSW 6 48932429 missense probably damaging 0.98
R2021:1600015I10Rik UTSW 6 48931451 missense probably damaging 1.00
R3771:1600015I10Rik UTSW 6 48931196 missense probably damaging 1.00
R4208:1600015I10Rik UTSW 6 48931647 missense probably damaging 1.00
R4790:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5114:1600015I10Rik UTSW 6 48931358 missense probably benign 0.02
R5610:1600015I10Rik UTSW 6 48931019 missense probably benign 0.00
R5823:1600015I10Rik UTSW 6 48930552 missense probably damaging 0.99
R5847:1600015I10Rik UTSW 6 48933478 missense probably damaging 1.00
R6233:1600015I10Rik UTSW 6 48930965 missense probably benign
R6357:1600015I10Rik UTSW 6 48930974 missense probably benign 0.00
R6694:1600015I10Rik UTSW 6 48930546 missense probably benign 0.21
R6733:1600015I10Rik UTSW 6 48930530 missense probably damaging 1.00
R6894:1600015I10Rik UTSW 6 48930662 missense probably damaging 1.00
R6898:1600015I10Rik UTSW 6 48931041 missense probably damaging 0.97
R6916:1600015I10Rik UTSW 6 48931053 missense probably benign 0.01
R7242:1600015I10Rik UTSW 6 48931128 missense probably damaging 1.00
R7762:1600015I10Rik UTSW 6 48932686 missense probably benign 0.07
R8257:1600015I10Rik UTSW 6 48932497 missense probably benign 0.04
X0062:1600015I10Rik UTSW 6 48933132 missense possibly damaging 0.55
Z1176:1600015I10Rik UTSW 6 48932468 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- AGACATCAGGCACTTGGAAATACC -3'
(R):5'- GAAAATTGCCCATCGCCCTC -3'

Sequencing Primer
(F):5'- GGCACTTGGAAATACCCTAAAG -3'
(R):5'- GGCAGGATCTCTGTATGCATTTCC -3'
Posted On2020-09-02