Incidental Mutation 'R8391:Hint1'
ID647392
Institutional Source Beutler Lab
Gene Symbol Hint1
Ensembl Gene ENSMUSG00000020267
Gene Namehistidine triad nucleotide binding protein 1
SynonymsIpk1, PKCI-1, PKC inhibitor/ interacting protein, protein kinase C inhibitor 1, PRKCNH1
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R8391 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location54866383-54870501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 54866542 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 18 (I18T)
Ref Sequence ENSEMBL: ENSMUSP00000020504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020504] [ENSMUST00000117710]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020504
AA Change: I18T

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020504
Gene: ENSMUSG00000020267
AA Change: I18T

DomainStartEndE-ValueType
Pfam:DcpS_C 16 123 3.9e-29 PFAM
Pfam:HIT 24 121 7.3e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117710
AA Change: I18T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114037
Gene: ENSMUSG00000020267
AA Change: I18T

DomainStartEndE-ValueType
Pfam:DcpS_C 16 78 7.6e-16 PFAM
Pfam:HIT 24 84 4.7e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that hydrolyzes purine nucleotide phosphoramidates substrates, including AMP-morpholidate, AMP-N-alanine methyl ester, AMP-alpha-acetyl lysine methyl ester, and AMP-NH2. The encoded protein interacts with these substrates via a histidine triad motif. This gene is considered a tumor suppressor gene. In addition, mutations in this gene can cause autosomal recessive neuromyotonia and axonal neuropathy. There are several related pseudogenes on chromosome 7. Several transcript variants have been observed. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant animals do not exhibit an overt phenotype, though one line of mutant mice was shown to be more susceptible to carcinogen-induced tumors than wild-type. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik T C 6: 48,932,668 W616R probably damaging Het
Abcf3 T C 16: 20,550,218 S155P possibly damaging Het
Akr1c21 C T 13: 4,576,279 R101W probably damaging Het
Angpt1 T A 15: 42,512,398 N154I probably damaging Het
Atp2a1 T A 7: 126,448,716 I641F possibly damaging Het
Bach1 G A 16: 87,719,291 R240Q probably benign Het
Cacna1b G A 2: 24,706,200 A493V probably damaging Het
Cacna1h G A 17: 25,377,230 A1939V probably benign Het
Cacna2d4 A G 6: 119,348,745 I1027V probably benign Het
Cbln3 G A 14: 55,883,066 R170C probably damaging Het
Cemip T C 7: 83,955,309 S842G probably damaging Het
Cep164 T A 9: 45,807,193 Q284L unknown Het
Crybg2 T C 4: 134,075,724 F889L probably damaging Het
Fam160a1 T C 3: 85,688,481 N366D probably damaging Het
Gars T A 6: 55,048,142 Y124N probably damaging Het
Gbp2b T C 3: 142,604,133 F228S probably damaging Het
Gm5565 C A 5: 146,160,152 R59L probably benign Het
Gm8947 A T 1: 151,192,986 D190V probably benign Het
Grid2ip T C 5: 143,380,196 M543T probably damaging Het
Gucy2c A G 6: 136,704,215 L957P probably damaging Het
Il23r T C 6: 67,452,390 S323G probably benign Het
Iqcf3 T G 9: 106,560,976 E16A unknown Het
Kcnj1 A T 9: 32,396,732 T151S probably damaging Het
Kdm1a G T 4: 136,553,843 T685K probably benign Het
Lipo4 T A 19: 33,511,565 H206L probably benign Het
Lrp5 A G 19: 3,604,185 Y1081H probably damaging Het
Masp1 A T 16: 23,470,378 H557Q possibly damaging Het
Nhsl1 C T 10: 18,524,943 T605I possibly damaging Het
Olfr366 T A 2: 37,220,265 Y259N probably damaging Het
Olfr50 C T 2: 36,794,084 P283S probably damaging Het
Pkmyt1 C T 17: 23,735,039 R307C probably damaging Het
Plppr4 T C 3: 117,335,411 I136V probably benign Het
Ppp1r12c A C 7: 4,497,432 Y150D probably damaging Het
Qrich2 C G 11: 116,465,577 V149L probably benign Het
R3hdm1 T C 1: 128,193,478 F176L Het
Ric8a T A 7: 140,858,003 S52T probably benign Het
Romo1 G T 2: 156,144,420 probably benign Het
Rps6ka1 G A 4: 133,864,035 H318Y probably damaging Het
Slc43a3 A G 2: 84,937,807 N41S probably benign Het
Srrm4 T G 5: 116,444,696 T567P unknown Het
Srsf12 C G 4: 33,226,070 P111R probably damaging Het
St6galnac4 G T 2: 32,594,074 D95Y probably damaging Het
Sult2a6 T C 7: 14,222,591 probably null Het
Synj2 A G 17: 5,941,521 E24G probably damaging Het
Try10 T G 6: 41,357,372 L166R probably damaging Het
Ttn A G 2: 76,732,200 V28767A probably damaging Het
Ttn T A 2: 76,774,478 I18371F probably damaging Het
Uhrf1bp1l T C 10: 89,809,743 V1226A possibly damaging Het
Zc3h13 T A 14: 75,331,185 L1306Q probably damaging Het
Zp2 T A 7: 120,126,956 T674S probably benign Het
Zscan4-ps3 A G 7: 11,612,874 Y279C probably benign Het
Other mutations in Hint1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02621:Hint1 APN 11 54870185 utr 3 prime probably benign
PIT4469001:Hint1 UTSW 11 54870070 missense unknown
R6312:Hint1 UTSW 11 54869990 missense probably benign 0.10
R8879:Hint1 UTSW 11 54869943 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGAAAGGGCGTTTCCTCC -3'
(R):5'- CACGGGTCTGCACTTTACAG -3'

Sequencing Primer
(F):5'- GCCCATTTCGTTCCCTCG -3'
(R):5'- TCTGCACTTTACAGGGGGC -3'
Posted On2020-09-02