Incidental Mutation 'R8392:Kdsr'
ID647406
Institutional Source Beutler Lab
Gene Symbol Kdsr
Ensembl Gene ENSMUSG00000009905
Gene Name3-ketodihydrosphingosine reductase
SynonymsFvt1, 6330410P18Rik, 9430079B08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R8392 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location106720459-106759727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106743853 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 142 (M142K)
Ref Sequence ENSEMBL: ENSMUSP00000010049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010049]
Predicted Effect probably damaging
Transcript: ENSMUST00000010049
AA Change: M142K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010049
Gene: ENSMUSG00000009905
AA Change: M142K

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:KR 33 214 9.4e-16 PFAM
Pfam:adh_short 33 232 1.1e-59 PFAM
Pfam:adh_short_C2 39 217 5.7e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the reduction of 3-ketodihydrosphingosine to dihydrosphingosine. The putative active site residues of the encoded protein are found on the cytosolic side of the endoplasmic reticulum membrane. A chromosomal rearrangement involving this gene is a cause of follicular lymphoma, also known as type II chronic lymphatic leukemia. The mutation of a conserved residue in the bovine ortholog causes spinal muscular atrophy. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 G A 5: 81,646,550 A473T probably benign Het
Ano2 T A 6: 125,880,735 N512K probably benign Het
Arhgap18 A T 10: 26,845,940 Y41F probably benign Het
Baz1a T A 12: 54,923,123 D584V probably damaging Het
Ccl2 A T 11: 82,036,982 Q84L probably damaging Het
Cdv3 T A 9: 103,355,275 H245L probably benign Het
Cfap54 T G 10: 92,962,417 K1660T unknown Het
Col4a1 T A 8: 11,208,333 probably null Het
Cpeb3 TTGCTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCTG 19: 37,174,891 probably benign Het
Crebbp G A 16: 4,084,281 R2365W possibly damaging Het
Ctsc A T 7: 88,297,243 Q160L probably benign Het
Cyp4a10 C T 4: 115,529,478 R441* probably null Het
Cyp8b1 T C 9: 121,915,234 E344G probably damaging Het
Dnah12 T C 14: 26,885,912 F3801L probably benign Het
Dnhd1 A G 7: 105,703,343 R2568G possibly damaging Het
Erbin T A 13: 103,834,062 E1015D probably damaging Het
Filip1l A G 16: 57,571,353 E768G probably damaging Het
Hist1h2ai C T 13: 21,716,486 A22V unknown Het
Ildr1 G T 16: 36,722,359 D418Y probably damaging Het
Ildr1 G A 16: 36,722,358 W417* probably null Het
Ispd T A 12: 36,390,498 L135Q probably damaging Het
Kidins220 T A 12: 24,990,728 V111E probably damaging Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Muc13 G A 16: 33,799,419 G179D unknown Het
Nebl T A 2: 17,452,552 T66S probably benign Het
Npsr1 T A 9: 24,310,081 I277N possibly damaging Het
Olfr352 T G 2: 36,870,340 I258S probably damaging Het
Olfr806 T A 10: 129,738,041 N292I probably damaging Het
Pcdha11 T A 18: 37,006,159 Y280* probably null Het
Pitrm1 T C 13: 6,549,660 I46T probably benign Het
Plxnc1 A G 10: 94,801,490 V1308A possibly damaging Het
Ppp1r9a T C 6: 5,143,491 probably null Het
Ptgdr A G 14: 44,858,922 M111T probably damaging Het
Rab3gap1 A G 1: 127,938,633 K850R probably benign Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Smtnl2 T A 11: 72,403,167 M188L probably benign Het
Snip1 G A 4: 125,066,825 V25M probably damaging Het
Spock3 A C 8: 63,355,311 D411A unknown Het
Sptbn4 C T 7: 27,372,296 R1581H probably damaging Het
Stard13 A G 5: 151,042,162 S1080P probably benign Het
Svep1 A T 4: 58,070,566 C2407S possibly damaging Het
Tanc1 T C 2: 59,806,307 S845P probably damaging Het
Tnfsf13 T C 11: 69,683,862 Y202C probably damaging Het
Top1 T A 2: 160,717,454 C632* probably null Het
Tsr1 C A 11: 74,900,270 T225K probably benign Het
Other mutations in Kdsr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01295:Kdsr APN 1 106755457 missense possibly damaging 0.91
IGL01375:Kdsr APN 1 106727694 missense probably benign 0.06
R0361:Kdsr UTSW 1 106747787 missense probably damaging 0.97
R1051:Kdsr UTSW 1 106747580 nonsense probably null
R1589:Kdsr UTSW 1 106734541 splice site probably null
R1679:Kdsr UTSW 1 106753226 missense probably benign 0.01
R4890:Kdsr UTSW 1 106753234 missense probably benign 0.21
R5392:Kdsr UTSW 1 106753241 missense possibly damaging 0.88
R5500:Kdsr UTSW 1 106759644 unclassified probably benign
R5830:Kdsr UTSW 1 106747532 missense possibly damaging 0.89
R5850:Kdsr UTSW 1 106755442 critical splice donor site probably null
R6005:Kdsr UTSW 1 106734581 missense probably benign 0.01
R7515:Kdsr UTSW 1 106734560 missense possibly damaging 0.89
R7841:Kdsr UTSW 1 106743685 missense probably damaging 1.00
R8282:Kdsr UTSW 1 106724997 missense probably benign 0.03
R8312:Kdsr UTSW 1 106747486 critical splice donor site probably null
R8507:Kdsr UTSW 1 106743670 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTTCTGCCAATCCTCTTATGG -3'
(R):5'- GTTCACTTCCCCATACAATATTCAG -3'

Sequencing Primer
(F):5'- CCTCTTATGGCAAACTTGGATG -3'
(R):5'- CAGAGGCTCAGTCCATTATGATCG -3'
Posted On2020-09-02