Incidental Mutation 'R0020:Prss43'
ID64742
Institutional Source Beutler Lab
Gene Symbol Prss43
Ensembl Gene ENSMUSG00000058398
Gene Nameprotease, serine 43
SynonymsLOC272643, Tessp3
MMRRC Submission 038315-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0020 (G1)
Quality Score106
Status Validated
Chromosome9
Chromosomal Location110826690-110831839 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to A at 110828512 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077549] [ENSMUST00000141089]
Predicted Effect probably benign
Transcript: ENSMUST00000077549
SMART Domains Protein: ENSMUSP00000076752
Gene: ENSMUSG00000058398

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 41 49 N/A INTRINSIC
Tryp_SPc 115 350 5.86e-58 SMART
transmembrane domain 362 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141089
SMART Domains Protein: ENSMUSP00000117039
Gene: ENSMUSG00000032493

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Trypsin 112 144 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.9%
  • 20x: 96.4%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,716,197 D2032E probably damaging Het
Ado T C 10: 67,548,097 D226G probably benign Het
Agfg2 C T 5: 137,653,802 V432M probably benign Het
Atf2 T C 2: 73,846,284 D122G possibly damaging Het
AW549877 T C 15: 3,991,868 probably benign Het
C330027C09Rik A T 16: 49,001,612 H201L probably damaging Het
Cd2bp2 G A 7: 127,193,824 T342M probably damaging Het
Col6a3 T A 1: 90,811,550 I319F probably damaging Het
Cst11 T A 2: 148,771,333 Y24F probably damaging Het
Cstb T A 10: 78,427,336 V65E probably benign Het
Cyp2j11 G A 4: 96,307,404 H352Y probably benign Het
D130043K22Rik T A 13: 24,854,492 probably benign Het
Dbh A G 2: 27,170,572 probably benign Het
Dhdh T C 7: 45,488,104 K53R probably benign Het
Drc3 A G 11: 60,370,545 Y174C probably damaging Het
Ezr G T 17: 6,742,727 Q308K probably damaging Het
F3 A T 3: 121,731,616 N169Y probably damaging Het
Fbn2 G T 18: 58,105,164 T587K probably damaging Het
Fhl5 A T 4: 25,200,054 V260E probably benign Het
Glyr1 A G 16: 5,037,049 I55T probably damaging Het
Gm12695 G C 4: 96,769,735 P66A probably damaging Het
Gm6614 A T 6: 141,972,350 V600E possibly damaging Het
Gon4l G T 3: 88,858,937 V428L probably damaging Het
Grasp T C 15: 101,230,552 V157A probably damaging Het
Ighv6-5 T C 12: 114,416,621 D92G probably null Het
Inhba A C 13: 16,026,364 K170N possibly damaging Het
Kng2 A G 16: 22,997,296 V317A probably benign Het
Larp1 T A 11: 58,050,023 D658E probably damaging Het
Map3k14 T C 11: 103,227,674 E562G probably damaging Het
Megf10 G T 18: 57,287,893 V868F possibly damaging Het
Nap1l1 A C 10: 111,491,023 E148D probably benign Het
Nlrp4a A T 7: 26,450,372 H468L probably damaging Het
Nphs1 G T 7: 30,463,208 V357L probably benign Het
Olfr432 T A 1: 174,050,847 V158E probably damaging Het
Pclo A G 5: 14,669,673 T1275A unknown Het
Pde4d T A 13: 109,954,570 C35S possibly damaging Het
Pkd1l1 A G 11: 8,875,765 probably benign Het
Pkd2 A G 5: 104,503,516 E910G probably damaging Het
Pot1b T A 17: 55,653,429 M634L probably benign Het
Ppp2r5c C T 12: 110,574,823 Q469* probably null Het
Ppp6r2 T A 15: 89,259,139 M163K probably damaging Het
Rb1cc1 C A 1: 6,264,548 N1444K possibly damaging Het
Scube2 A G 7: 109,830,888 probably benign Het
Slamf9 T C 1: 172,475,515 S7P possibly damaging Het
Slc35b2 T A 17: 45,566,856 M303K probably damaging Het
Slc4a7 T A 14: 14,796,108 F1116I probably benign Het
Smarcad1 T A 6: 65,084,007 probably benign Het
Tns3 A C 11: 8,545,227 probably null Het
Zfp282 T G 6: 47,880,009 W59G probably damaging Het
Zfp746 C A 6: 48,064,707 A362S probably benign Het
Other mutations in Prss43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Prss43 APN 9 110829470 missense probably benign 0.02
IGL01636:Prss43 APN 9 110827437 missense possibly damaging 0.75
IGL03046:Prss43 UTSW 9 110830981 missense probably benign 0.01
PIT4576001:Prss43 UTSW 9 110827887 missense probably damaging 1.00
R0278:Prss43 UTSW 9 110827362 missense probably benign 0.07
R0883:Prss43 UTSW 9 110829508 missense probably damaging 1.00
R1384:Prss43 UTSW 9 110827442 missense probably benign 0.10
R2212:Prss43 UTSW 9 110829464 missense probably damaging 1.00
R3412:Prss43 UTSW 9 110829464 missense probably damaging 1.00
R3808:Prss43 UTSW 9 110827772 missense probably damaging 1.00
R4202:Prss43 UTSW 9 110827461 missense probably benign 0.08
R4530:Prss43 UTSW 9 110829504 missense probably benign 0.38
R4752:Prss43 UTSW 9 110827768 missense possibly damaging 0.47
R5009:Prss43 UTSW 9 110827421 missense possibly damaging 0.50
R6920:Prss43 UTSW 9 110828612 missense probably benign 0.04
R7271:Prss43 UTSW 9 110828603 missense probably damaging 1.00
R7406:Prss43 UTSW 9 110828696 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTACACTGGTCTAGGAACCAC -3'
(R):5'- TTCCGAATCCTGCCAGACAGACTC -3'

Sequencing Primer
(F):5'- cactggtctaggaaccacacttG -3'
(R):5'- GACAGACTCACCAATTTCGTTC -3'
Posted On2013-08-06