Incidental Mutation 'R8392:Plxnc1'
ID 647431
Institutional Source Beutler Lab
Gene Symbol Plxnc1
Ensembl Gene ENSMUSG00000074785
Gene Name plexin C1
Synonyms 2510048K12Rik, vespr, CD232
MMRRC Submission 067757-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.431) question?
Stock # R8392 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 94626728-94780697 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 94637352 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1308 (V1308A)
Ref Sequence ENSEMBL: ENSMUSP00000096939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099337]
AlphaFold Q9QZC2
Predicted Effect possibly damaging
Transcript: ENSMUST00000099337
AA Change: V1308A

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785
AA Change: V1308A

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Sema 87 431 5.5e-10 PFAM
PSI 454 507 5.28e-12 SMART
PSI 590 634 1.07e-3 SMART
Pfam:TIG 665 752 3.7e-9 PFAM
IPT 755 847 5.14e-7 SMART
IPT 849 954 1.8e-2 SMART
low complexity region 978 997 N/A INTRINSIC
Pfam:Plexin_cytopl 1018 1541 1.4e-199 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 G A 5: 81,794,397 (GRCm39) A473T probably benign Het
Ano2 T A 6: 125,857,698 (GRCm39) N512K probably benign Het
Arhgap18 A T 10: 26,721,936 (GRCm39) Y41F probably benign Het
Baz1a T A 12: 54,969,908 (GRCm39) D584V probably damaging Het
Ccl2 A T 11: 81,927,808 (GRCm39) Q84L probably damaging Het
Cdv3 T A 9: 103,232,474 (GRCm39) H245L probably benign Het
Cfap54 T G 10: 92,798,279 (GRCm39) K1660T unknown Het
Col4a1 T A 8: 11,258,333 (GRCm39) probably null Het
Cpeb3 TTGCTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCTG 19: 37,152,291 (GRCm39) probably benign Het
Crebbp G A 16: 3,902,145 (GRCm39) R2365W possibly damaging Het
Crppa T A 12: 36,440,497 (GRCm39) L135Q probably damaging Het
Ctsc A T 7: 87,946,451 (GRCm39) Q160L probably benign Het
Cyp4a10 C T 4: 115,386,675 (GRCm39) R441* probably null Het
Cyp8b1 T C 9: 121,744,300 (GRCm39) E344G probably damaging Het
Dnah12 T C 14: 26,607,869 (GRCm39) F3801L probably benign Het
Dnhd1 A G 7: 105,352,550 (GRCm39) R2568G possibly damaging Het
Erbin T A 13: 103,970,570 (GRCm39) E1015D probably damaging Het
Filip1l A G 16: 57,391,716 (GRCm39) E768G probably damaging Het
H2ac13 C T 13: 21,900,656 (GRCm39) A22V unknown Het
Ildr1 G A 16: 36,542,720 (GRCm39) W417* probably null Het
Ildr1 G T 16: 36,542,721 (GRCm39) D418Y probably damaging Het
Kdsr A T 1: 106,671,583 (GRCm39) M142K probably damaging Het
Kidins220 T A 12: 25,040,727 (GRCm39) V111E probably damaging Het
Ly75 T C 2: 60,180,284 (GRCm39) E631G probably benign Het
Muc13 G A 16: 33,619,789 (GRCm39) G179D unknown Het
Nebl T A 2: 17,457,363 (GRCm39) T66S probably benign Het
Npsr1 T A 9: 24,221,377 (GRCm39) I277N possibly damaging Het
Or1j20 T G 2: 36,760,352 (GRCm39) I258S probably damaging Het
Or6c213 T A 10: 129,573,910 (GRCm39) N292I probably damaging Het
Pcdha11 T A 18: 37,139,212 (GRCm39) Y280* probably null Het
Pitrm1 T C 13: 6,599,696 (GRCm39) I46T probably benign Het
Ppp1r9a T C 6: 5,143,491 (GRCm39) probably null Het
Ptgdr A G 14: 45,096,379 (GRCm39) M111T probably damaging Het
Rab3gap1 A G 1: 127,866,370 (GRCm39) K850R probably benign Het
Rsf1 G GACGGCGGCC 7: 97,229,116 (GRCm39) probably benign Het
Smtnl2 T A 11: 72,293,993 (GRCm39) M188L probably benign Het
Snip1 G A 4: 124,960,618 (GRCm39) V25M probably damaging Het
Spock3 A C 8: 63,808,345 (GRCm39) D411A unknown Het
Sptbn4 C T 7: 27,071,721 (GRCm39) R1581H probably damaging Het
Stard13 A G 5: 150,965,627 (GRCm39) S1080P probably benign Het
Svep1 A T 4: 58,070,566 (GRCm39) C2407S possibly damaging Het
Tanc1 T C 2: 59,636,651 (GRCm39) S845P probably damaging Het
Tnfsf13 T C 11: 69,574,688 (GRCm39) Y202C probably damaging Het
Top1 T A 2: 160,559,374 (GRCm39) C632* probably null Het
Tsr1 C A 11: 74,791,096 (GRCm39) T225K probably benign Het
Other mutations in Plxnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Plxnc1 APN 10 94,683,411 (GRCm39) missense probably benign 0.25
IGL01285:Plxnc1 APN 10 94,635,230 (GRCm39) missense probably damaging 0.99
IGL01867:Plxnc1 APN 10 94,634,008 (GRCm39) missense possibly damaging 0.61
IGL01994:Plxnc1 APN 10 94,685,801 (GRCm39) missense probably damaging 1.00
IGL02083:Plxnc1 APN 10 94,758,587 (GRCm39) missense possibly damaging 0.61
IGL02250:Plxnc1 APN 10 94,706,893 (GRCm39) missense probably benign 0.00
IGL02429:Plxnc1 APN 10 94,718,453 (GRCm39) missense probably benign 0.00
IGL02752:Plxnc1 APN 10 94,630,542 (GRCm39) splice site probably null
IGL02973:Plxnc1 APN 10 94,646,546 (GRCm39) missense probably damaging 1.00
R0230:Plxnc1 UTSW 10 94,635,209 (GRCm39) missense probably benign 0.07
R0265:Plxnc1 UTSW 10 94,648,991 (GRCm39) missense probably benign 0.14
R0271:Plxnc1 UTSW 10 94,673,780 (GRCm39) missense probably null 1.00
R0299:Plxnc1 UTSW 10 94,685,683 (GRCm39) critical splice donor site probably null
R0361:Plxnc1 UTSW 10 94,700,869 (GRCm39) missense probably damaging 1.00
R0441:Plxnc1 UTSW 10 94,632,344 (GRCm39) missense probably damaging 1.00
R0558:Plxnc1 UTSW 10 94,673,797 (GRCm39) missense probably damaging 1.00
R0617:Plxnc1 UTSW 10 94,635,230 (GRCm39) missense probably damaging 1.00
R0671:Plxnc1 UTSW 10 94,635,194 (GRCm39) missense possibly damaging 0.63
R0692:Plxnc1 UTSW 10 94,673,362 (GRCm39) critical splice donor site probably null
R0751:Plxnc1 UTSW 10 94,667,195 (GRCm39) splice site probably benign
R1184:Plxnc1 UTSW 10 94,667,195 (GRCm39) splice site probably benign
R1260:Plxnc1 UTSW 10 94,667,227 (GRCm39) missense probably damaging 0.99
R1680:Plxnc1 UTSW 10 94,677,413 (GRCm39) missense probably benign 0.14
R1746:Plxnc1 UTSW 10 94,680,041 (GRCm39) splice site probably null
R1750:Plxnc1 UTSW 10 94,635,359 (GRCm39) missense probably damaging 1.00
R1751:Plxnc1 UTSW 10 94,685,677 (GRCm39) unclassified probably benign
R1768:Plxnc1 UTSW 10 94,680,184 (GRCm39) missense probably benign 0.05
R1876:Plxnc1 UTSW 10 94,702,803 (GRCm39) missense possibly damaging 0.94
R2004:Plxnc1 UTSW 10 94,688,484 (GRCm39) missense probably damaging 0.98
R2031:Plxnc1 UTSW 10 94,779,529 (GRCm39) missense probably benign 0.26
R2184:Plxnc1 UTSW 10 94,780,131 (GRCm39) missense probably damaging 1.00
R2437:Plxnc1 UTSW 10 94,742,395 (GRCm39) missense probably benign 0.02
R2927:Plxnc1 UTSW 10 94,629,154 (GRCm39) critical splice acceptor site probably null
R3001:Plxnc1 UTSW 10 94,629,080 (GRCm39) missense probably damaging 0.98
R3002:Plxnc1 UTSW 10 94,629,080 (GRCm39) missense probably damaging 0.98
R3003:Plxnc1 UTSW 10 94,629,080 (GRCm39) missense probably damaging 0.98
R3441:Plxnc1 UTSW 10 94,706,872 (GRCm39) missense probably benign 0.00
R3849:Plxnc1 UTSW 10 94,630,294 (GRCm39) missense probably benign 0.01
R3884:Plxnc1 UTSW 10 94,746,549 (GRCm39) splice site probably null
R4004:Plxnc1 UTSW 10 94,630,459 (GRCm39) nonsense probably null
R4679:Plxnc1 UTSW 10 94,630,306 (GRCm39) missense probably damaging 1.00
R4730:Plxnc1 UTSW 10 94,703,330 (GRCm39) intron probably benign
R4937:Plxnc1 UTSW 10 94,677,335 (GRCm39) missense probably damaging 1.00
R5068:Plxnc1 UTSW 10 94,635,239 (GRCm39) missense possibly damaging 0.91
R5345:Plxnc1 UTSW 10 94,685,831 (GRCm39) missense probably benign 0.26
R5397:Plxnc1 UTSW 10 94,679,614 (GRCm39) missense probably benign 0.08
R5416:Plxnc1 UTSW 10 94,673,416 (GRCm39) missense probably damaging 1.00
R5485:Plxnc1 UTSW 10 94,758,604 (GRCm39) missense probably benign 0.00
R5543:Plxnc1 UTSW 10 94,700,636 (GRCm39) missense probably benign
R5826:Plxnc1 UTSW 10 94,635,335 (GRCm39) critical splice donor site probably null
R6007:Plxnc1 UTSW 10 94,629,152 (GRCm39) missense possibly damaging 0.88
R6018:Plxnc1 UTSW 10 94,779,710 (GRCm39) missense probably benign 0.21
R6052:Plxnc1 UTSW 10 94,779,635 (GRCm39) missense probably benign 0.13
R6291:Plxnc1 UTSW 10 94,669,504 (GRCm39) splice site probably null
R6653:Plxnc1 UTSW 10 94,779,738 (GRCm39) missense probably damaging 1.00
R6984:Plxnc1 UTSW 10 94,667,392 (GRCm39) missense probably damaging 1.00
R7086:Plxnc1 UTSW 10 94,667,297 (GRCm39) missense probably benign
R7401:Plxnc1 UTSW 10 94,706,867 (GRCm39) missense probably benign
R7727:Plxnc1 UTSW 10 94,779,971 (GRCm39) missense probably damaging 1.00
R7789:Plxnc1 UTSW 10 94,630,339 (GRCm39) missense probably damaging 1.00
R7803:Plxnc1 UTSW 10 94,779,377 (GRCm39) critical splice donor site probably null
R7809:Plxnc1 UTSW 10 94,630,302 (GRCm39) missense probably damaging 1.00
R7882:Plxnc1 UTSW 10 94,679,698 (GRCm39) missense probably benign
R8103:Plxnc1 UTSW 10 94,706,944 (GRCm39) missense probably benign
R8226:Plxnc1 UTSW 10 94,669,230 (GRCm39) missense possibly damaging 0.90
R8273:Plxnc1 UTSW 10 94,649,105 (GRCm39) missense probably benign 0.14
R8299:Plxnc1 UTSW 10 94,663,041 (GRCm39) missense probably benign 0.35
R8758:Plxnc1 UTSW 10 94,758,607 (GRCm39) missense possibly damaging 0.91
R8806:Plxnc1 UTSW 10 94,635,140 (GRCm39) missense probably damaging 1.00
R8882:Plxnc1 UTSW 10 94,677,428 (GRCm39) missense probably damaging 1.00
R8893:Plxnc1 UTSW 10 94,685,709 (GRCm39) missense probably benign 0.35
R8956:Plxnc1 UTSW 10 94,746,448 (GRCm39) missense probably benign 0.00
R9040:Plxnc1 UTSW 10 94,779,379 (GRCm39) nonsense probably null
R9102:Plxnc1 UTSW 10 94,663,107 (GRCm39) missense probably damaging 1.00
R9225:Plxnc1 UTSW 10 94,629,061 (GRCm39) missense probably damaging 1.00
R9324:Plxnc1 UTSW 10 94,780,685 (GRCm39) start gained probably benign
R9368:Plxnc1 UTSW 10 94,700,599 (GRCm39) nonsense probably null
R9375:Plxnc1 UTSW 10 94,649,093 (GRCm39) missense probably benign 0.20
R9430:Plxnc1 UTSW 10 94,758,544 (GRCm39) missense probably benign 0.01
R9460:Plxnc1 UTSW 10 94,700,895 (GRCm39) missense probably benign
R9498:Plxnc1 UTSW 10 94,649,004 (GRCm39) missense possibly damaging 0.48
RF003:Plxnc1 UTSW 10 94,630,306 (GRCm39) missense probably damaging 1.00
RF045:Plxnc1 UTSW 10 94,700,869 (GRCm39) missense probably damaging 1.00
RF046:Plxnc1 UTSW 10 94,700,869 (GRCm39) missense probably damaging 1.00
RF047:Plxnc1 UTSW 10 94,700,869 (GRCm39) missense probably damaging 1.00
X0024:Plxnc1 UTSW 10 94,700,577 (GRCm39) critical splice donor site probably null
Z1176:Plxnc1 UTSW 10 94,700,891 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGGCTTGTCTCAGCTTCCAG -3'
(R):5'- GTCTATGTGTATCCTTCACAGGGC -3'

Sequencing Primer
(F):5'- GCTTCCAGAGAATTACATAGCAG -3'
(R):5'- GAGCCCCTTGAACTCAGACAGTG -3'
Posted On 2020-09-02