Incidental Mutation 'R8392:Plxnc1'
ID 647431
Institutional Source Beutler Lab
Gene Symbol Plxnc1
Ensembl Gene ENSMUSG00000074785
Gene Name plexin C1
Synonyms CD232, vespr, 2510048K12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock # R8392 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 94790866-94944835 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 94801490 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1308 (V1308A)
Ref Sequence ENSEMBL: ENSMUSP00000096939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099337]
AlphaFold Q9QZC2
Predicted Effect possibly damaging
Transcript: ENSMUST00000099337
AA Change: V1308A

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000096939
Gene: ENSMUSG00000074785
AA Change: V1308A

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Sema 87 431 5.5e-10 PFAM
PSI 454 507 5.28e-12 SMART
PSI 590 634 1.07e-3 SMART
Pfam:TIG 665 752 3.7e-9 PFAM
IPT 755 847 5.14e-7 SMART
IPT 849 954 1.8e-2 SMART
low complexity region 978 997 N/A INTRINSIC
Pfam:Plexin_cytopl 1018 1541 1.4e-199 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin family. Plexins are transmembrane receptors for semaphorins, a large family of proteins that regulate axon guidance, cell motility and migration, and the immune response. The encoded protein and its ligand regulate melanocyte adhesion, and viral semaphorins may modulate the immune response by binding to this receptor. The encoded protein may be a tumor suppressor protein for melanoma. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal neuron morphology and migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 G A 5: 81,646,550 A473T probably benign Het
Ano2 T A 6: 125,880,735 N512K probably benign Het
Arhgap18 A T 10: 26,845,940 Y41F probably benign Het
Baz1a T A 12: 54,923,123 D584V probably damaging Het
Ccl2 A T 11: 82,036,982 Q84L probably damaging Het
Cdv3 T A 9: 103,355,275 H245L probably benign Het
Cfap54 T G 10: 92,962,417 K1660T unknown Het
Col4a1 T A 8: 11,208,333 probably null Het
Cpeb3 TTGCTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCTG 19: 37,174,891 probably benign Het
Crebbp G A 16: 4,084,281 R2365W possibly damaging Het
Ctsc A T 7: 88,297,243 Q160L probably benign Het
Cyp4a10 C T 4: 115,529,478 R441* probably null Het
Cyp8b1 T C 9: 121,915,234 E344G probably damaging Het
Dnah12 T C 14: 26,885,912 F3801L probably benign Het
Dnhd1 A G 7: 105,703,343 R2568G possibly damaging Het
Erbin T A 13: 103,834,062 E1015D probably damaging Het
Filip1l A G 16: 57,571,353 E768G probably damaging Het
Hist1h2ai C T 13: 21,716,486 A22V unknown Het
Ildr1 G T 16: 36,722,359 D418Y probably damaging Het
Ildr1 G A 16: 36,722,358 W417* probably null Het
Ispd T A 12: 36,390,498 L135Q probably damaging Het
Kdsr A T 1: 106,743,853 M142K probably damaging Het
Kidins220 T A 12: 24,990,728 V111E probably damaging Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Muc13 G A 16: 33,799,419 G179D unknown Het
Nebl T A 2: 17,452,552 T66S probably benign Het
Npsr1 T A 9: 24,310,081 I277N possibly damaging Het
Olfr352 T G 2: 36,870,340 I258S probably damaging Het
Olfr806 T A 10: 129,738,041 N292I probably damaging Het
Pcdha11 T A 18: 37,006,159 Y280* probably null Het
Pitrm1 T C 13: 6,549,660 I46T probably benign Het
Ppp1r9a T C 6: 5,143,491 probably null Het
Ptgdr A G 14: 44,858,922 M111T probably damaging Het
Rab3gap1 A G 1: 127,938,633 K850R probably benign Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Smtnl2 T A 11: 72,403,167 M188L probably benign Het
Snip1 G A 4: 125,066,825 V25M probably damaging Het
Spock3 A C 8: 63,355,311 D411A unknown Het
Sptbn4 C T 7: 27,372,296 R1581H probably damaging Het
Stard13 A G 5: 151,042,162 S1080P probably benign Het
Svep1 A T 4: 58,070,566 C2407S possibly damaging Het
Tanc1 T C 2: 59,806,307 S845P probably damaging Het
Tnfsf13 T C 11: 69,683,862 Y202C probably damaging Het
Top1 T A 2: 160,717,454 C632* probably null Het
Tsr1 C A 11: 74,900,270 T225K probably benign Het
Other mutations in Plxnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Plxnc1 APN 10 94847549 missense probably benign 0.25
IGL01285:Plxnc1 APN 10 94799368 missense probably damaging 0.99
IGL01867:Plxnc1 APN 10 94798146 missense possibly damaging 0.61
IGL01994:Plxnc1 APN 10 94849939 missense probably damaging 1.00
IGL02083:Plxnc1 APN 10 94922725 missense possibly damaging 0.61
IGL02250:Plxnc1 APN 10 94871031 missense probably benign 0.00
IGL02429:Plxnc1 APN 10 94882591 missense probably benign 0.00
IGL02752:Plxnc1 APN 10 94794680 splice site probably null
IGL02973:Plxnc1 APN 10 94810684 missense probably damaging 1.00
R0230:Plxnc1 UTSW 10 94799347 missense probably benign 0.07
R0265:Plxnc1 UTSW 10 94813129 missense probably benign 0.14
R0271:Plxnc1 UTSW 10 94837918 missense probably null 1.00
R0299:Plxnc1 UTSW 10 94849821 critical splice donor site probably null
R0361:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
R0441:Plxnc1 UTSW 10 94796482 missense probably damaging 1.00
R0558:Plxnc1 UTSW 10 94837935 missense probably damaging 1.00
R0617:Plxnc1 UTSW 10 94799368 missense probably damaging 1.00
R0671:Plxnc1 UTSW 10 94799332 missense possibly damaging 0.63
R0692:Plxnc1 UTSW 10 94837500 critical splice donor site probably null
R0751:Plxnc1 UTSW 10 94831333 splice site probably benign
R1184:Plxnc1 UTSW 10 94831333 splice site probably benign
R1260:Plxnc1 UTSW 10 94831365 missense probably damaging 0.99
R1680:Plxnc1 UTSW 10 94841551 missense probably benign 0.14
R1746:Plxnc1 UTSW 10 94844179 splice site probably null
R1750:Plxnc1 UTSW 10 94799497 missense probably damaging 1.00
R1751:Plxnc1 UTSW 10 94849815 unclassified probably benign
R1768:Plxnc1 UTSW 10 94844322 missense probably benign 0.05
R1876:Plxnc1 UTSW 10 94866941 missense possibly damaging 0.94
R2004:Plxnc1 UTSW 10 94852622 missense probably damaging 0.98
R2031:Plxnc1 UTSW 10 94943667 missense probably benign 0.26
R2184:Plxnc1 UTSW 10 94944269 missense probably damaging 1.00
R2437:Plxnc1 UTSW 10 94906533 missense probably benign 0.02
R2927:Plxnc1 UTSW 10 94793292 critical splice acceptor site probably null
R3001:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3002:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3003:Plxnc1 UTSW 10 94793218 missense probably damaging 0.98
R3441:Plxnc1 UTSW 10 94871010 missense probably benign 0.00
R3849:Plxnc1 UTSW 10 94794432 missense probably benign 0.01
R3884:Plxnc1 UTSW 10 94910687 splice site probably null
R4004:Plxnc1 UTSW 10 94794597 nonsense probably null
R4679:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
R4730:Plxnc1 UTSW 10 94867468 intron probably benign
R4937:Plxnc1 UTSW 10 94841473 missense probably damaging 1.00
R5068:Plxnc1 UTSW 10 94799377 missense possibly damaging 0.91
R5345:Plxnc1 UTSW 10 94849969 missense probably benign 0.26
R5397:Plxnc1 UTSW 10 94843752 missense probably benign 0.08
R5416:Plxnc1 UTSW 10 94837554 missense probably damaging 1.00
R5485:Plxnc1 UTSW 10 94922742 missense probably benign 0.00
R5543:Plxnc1 UTSW 10 94864774 missense probably benign
R5826:Plxnc1 UTSW 10 94799473 critical splice donor site probably null
R6007:Plxnc1 UTSW 10 94793290 missense possibly damaging 0.88
R6018:Plxnc1 UTSW 10 94943848 missense probably benign 0.21
R6052:Plxnc1 UTSW 10 94943773 missense probably benign 0.13
R6291:Plxnc1 UTSW 10 94833642 splice site probably null
R6653:Plxnc1 UTSW 10 94943876 missense probably damaging 1.00
R6984:Plxnc1 UTSW 10 94831530 missense probably damaging 1.00
R7086:Plxnc1 UTSW 10 94831435 missense probably benign
R7401:Plxnc1 UTSW 10 94871005 missense probably benign
R7727:Plxnc1 UTSW 10 94944109 missense probably damaging 1.00
R7789:Plxnc1 UTSW 10 94794477 missense probably damaging 1.00
R7803:Plxnc1 UTSW 10 94943515 critical splice donor site probably null
R7809:Plxnc1 UTSW 10 94794440 missense probably damaging 1.00
R7882:Plxnc1 UTSW 10 94843836 missense probably benign
R8103:Plxnc1 UTSW 10 94871082 missense probably benign
R8226:Plxnc1 UTSW 10 94833368 missense possibly damaging 0.90
R8273:Plxnc1 UTSW 10 94813243 missense probably benign 0.14
R8299:Plxnc1 UTSW 10 94827179 missense probably benign 0.35
R8758:Plxnc1 UTSW 10 94922745 missense possibly damaging 0.91
R8806:Plxnc1 UTSW 10 94799278 missense probably damaging 1.00
R8882:Plxnc1 UTSW 10 94841566 missense probably damaging 1.00
R8893:Plxnc1 UTSW 10 94849847 missense probably benign 0.35
R8956:Plxnc1 UTSW 10 94910586 missense probably benign 0.00
R9040:Plxnc1 UTSW 10 94943517 nonsense probably null
R9102:Plxnc1 UTSW 10 94827245 missense probably damaging 1.00
R9225:Plxnc1 UTSW 10 94793199 missense probably damaging 1.00
R9324:Plxnc1 UTSW 10 94944823 start gained probably benign
R9368:Plxnc1 UTSW 10 94864737 nonsense probably null
R9375:Plxnc1 UTSW 10 94813231 missense probably benign 0.20
R9430:Plxnc1 UTSW 10 94922682 missense probably benign 0.01
R9460:Plxnc1 UTSW 10 94865033 missense probably benign
R9498:Plxnc1 UTSW 10 94813142 missense possibly damaging 0.48
RF003:Plxnc1 UTSW 10 94794444 missense probably damaging 1.00
RF045:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF046:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
RF047:Plxnc1 UTSW 10 94865007 missense probably damaging 1.00
X0024:Plxnc1 UTSW 10 94864715 critical splice donor site probably null
Z1176:Plxnc1 UTSW 10 94865029 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGGCTTGTCTCAGCTTCCAG -3'
(R):5'- GTCTATGTGTATCCTTCACAGGGC -3'

Sequencing Primer
(F):5'- GCTTCCAGAGAATTACATAGCAG -3'
(R):5'- GAGCCCCTTGAACTCAGACAGTG -3'
Posted On 2020-09-02