Incidental Mutation 'R8392:Ispd'
ID647438
Institutional Source Beutler Lab
Gene Symbol Ispd
Ensembl Gene ENSMUSG00000043153
Gene Nameisoprenoid synthase domain containing
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8392 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location36381450-36689503 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 36390498 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 135 (L135Q)
Ref Sequence ENSEMBL: ENSMUSP00000061646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062041] [ENSMUST00000220519] [ENSMUST00000221177] [ENSMUST00000221452] [ENSMUST00000221895] [ENSMUST00000223068] [ENSMUST00000223205]
Predicted Effect probably damaging
Transcript: ENSMUST00000062041
AA Change: L135Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061646
Gene: ENSMUSG00000043153
AA Change: L135Q

DomainStartEndE-ValueType
Pfam:IspD 45 277 2.5e-40 PFAM
Pfam:NTP_transf_3 47 274 3.1e-11 PFAM
low complexity region 359 370 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000220519
AA Change: L135Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221177
AA Change: L36Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221452
AA Change: L135Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000221895
AA Change: L135Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223068
AA Change: L36Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223205
AA Change: L135Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase-like protein. Mutations in this gene are the cause of Walker-Warburg syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit neonatal lethality due to respiratory failure, abnormal axon guidance and fasciculation, abnormal dorsal funiculus, detachment of radial glial cell endfeet and neuronal heterotopias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 G A 5: 81,646,550 A473T probably benign Het
Ano2 T A 6: 125,880,735 N512K probably benign Het
Arhgap18 A T 10: 26,845,940 Y41F probably benign Het
Baz1a T A 12: 54,923,123 D584V probably damaging Het
Ccl2 A T 11: 82,036,982 Q84L probably damaging Het
Cdv3 T A 9: 103,355,275 H245L probably benign Het
Cfap54 T G 10: 92,962,417 K1660T unknown Het
Col4a1 T A 8: 11,208,333 probably null Het
Cpeb3 TTGCTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCTG 19: 37,174,891 probably benign Het
Crebbp G A 16: 4,084,281 R2365W possibly damaging Het
Ctsc A T 7: 88,297,243 Q160L probably benign Het
Cyp4a10 C T 4: 115,529,478 R441* probably null Het
Cyp8b1 T C 9: 121,915,234 E344G probably damaging Het
Dnah12 T C 14: 26,885,912 F3801L probably benign Het
Dnhd1 A G 7: 105,703,343 R2568G possibly damaging Het
Erbin T A 13: 103,834,062 E1015D probably damaging Het
Filip1l A G 16: 57,571,353 E768G probably damaging Het
Hist1h2ai C T 13: 21,716,486 A22V unknown Het
Ildr1 G A 16: 36,722,358 W417* probably null Het
Ildr1 G T 16: 36,722,359 D418Y probably damaging Het
Kdsr A T 1: 106,743,853 M142K probably damaging Het
Kidins220 T A 12: 24,990,728 V111E probably damaging Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Muc13 G A 16: 33,799,419 G179D unknown Het
Nebl T A 2: 17,452,552 T66S probably benign Het
Npsr1 T A 9: 24,310,081 I277N possibly damaging Het
Olfr352 T G 2: 36,870,340 I258S probably damaging Het
Olfr806 T A 10: 129,738,041 N292I probably damaging Het
Pcdha11 T A 18: 37,006,159 Y280* probably null Het
Pitrm1 T C 13: 6,549,660 I46T probably benign Het
Plxnc1 A G 10: 94,801,490 V1308A possibly damaging Het
Ppp1r9a T C 6: 5,143,491 probably null Het
Ptgdr A G 14: 44,858,922 M111T probably damaging Het
Rab3gap1 A G 1: 127,938,633 K850R probably benign Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Smtnl2 T A 11: 72,403,167 M188L probably benign Het
Snip1 G A 4: 125,066,825 V25M probably damaging Het
Spock3 A C 8: 63,355,311 D411A unknown Het
Sptbn4 C T 7: 27,372,296 R1581H probably damaging Het
Stard13 A G 5: 151,042,162 S1080P probably benign Het
Svep1 A T 4: 58,070,566 C2407S possibly damaging Het
Tanc1 T C 2: 59,806,307 S845P probably damaging Het
Tnfsf13 T C 11: 69,683,862 Y202C probably damaging Het
Top1 T A 2: 160,717,454 C632* probably null Het
Tsr1 C A 11: 74,900,270 T225K probably benign Het
Other mutations in Ispd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Ispd APN 12 36473177 missense probably damaging 1.00
IGL01845:Ispd APN 12 36547919 missense probably benign 0.10
R0329:Ispd UTSW 12 36381838 missense possibly damaging 0.71
R0513:Ispd UTSW 12 36390468 missense probably damaging 1.00
R0798:Ispd UTSW 12 36521999 missense probably benign 0.26
R1676:Ispd UTSW 12 36476721 missense probably benign 0.02
R1704:Ispd UTSW 12 36521494 missense probably benign 0.00
R1937:Ispd UTSW 12 36390368 missense probably benign 0.13
R1987:Ispd UTSW 12 36521996 missense probably damaging 1.00
R4518:Ispd UTSW 12 36473180 missense possibly damaging 0.81
R5726:Ispd UTSW 12 36547830 missense probably damaging 0.99
R6508:Ispd UTSW 12 36426299 missense possibly damaging 0.92
R7315:Ispd UTSW 12 36390374 missense probably benign 0.00
R7395:Ispd UTSW 12 36501995 missense possibly damaging 0.86
R7819:Ispd UTSW 12 36381903 missense probably benign 0.00
R8810:Ispd UTSW 12 36390482 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCACATGCTTTCTTTGTAGAG -3'
(R):5'- AGGTCATTGTTCCCACTTACAG -3'

Sequencing Primer
(F):5'- CACATGCTTTCTTTGTAGAGTATGC -3'
(R):5'- CTATCAAAATTTAGCAAAGTGACCAC -3'
Posted On2020-09-02