Incidental Mutation 'R8392:Filip1l'
ID 647449
Institutional Source Beutler Lab
Gene Symbol Filip1l
Ensembl Gene ENSMUSG00000043336
Gene Name filamin A interacting protein 1-like
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8392 (G1)
Quality Score 225.009
Status Not validated
Chromosome 16
Chromosomal Location 57353093-57573126 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57571353 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 768 (E768G)
Ref Sequence ENSEMBL: ENSMUSP00000124179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114371] [ENSMUST00000159414] [ENSMUST00000159816] [ENSMUST00000232413]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000114371
SMART Domains Protein: ENSMUSP00000110011
Gene: ENSMUSG00000022748

DomainStartEndE-ValueType
low complexity region 13 29 N/A INTRINSIC
Pfam:CMS1 42 266 7.9e-35 PFAM
Pfam:DEAD 127 234 4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159414
AA Change: E530G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124069
Gene: ENSMUSG00000043336
AA Change: E530G

DomainStartEndE-ValueType
coiled coil region 4 345 N/A INTRINSIC
coiled coil region 371 542 N/A INTRINSIC
low complexity region 589 602 N/A INTRINSIC
low complexity region 868 879 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159816
AA Change: E768G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124179
Gene: ENSMUSG00000043336
AA Change: E768G

DomainStartEndE-ValueType
Pfam:CortBP2 61 246 1.8e-65 PFAM
low complexity region 271 286 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
coiled coil region 609 780 N/A INTRINSIC
low complexity region 827 840 N/A INTRINSIC
low complexity region 1106 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000232413
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 G A 5: 81,646,550 A473T probably benign Het
Ano2 T A 6: 125,880,735 N512K probably benign Het
Arhgap18 A T 10: 26,845,940 Y41F probably benign Het
Baz1a T A 12: 54,923,123 D584V probably damaging Het
Ccl2 A T 11: 82,036,982 Q84L probably damaging Het
Cdv3 T A 9: 103,355,275 H245L probably benign Het
Cfap54 T G 10: 92,962,417 K1660T unknown Het
Col4a1 T A 8: 11,208,333 probably null Het
Cpeb3 TTGCTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCCGCTGCTGCTGCTG 19: 37,174,891 probably benign Het
Crebbp G A 16: 4,084,281 R2365W possibly damaging Het
Ctsc A T 7: 88,297,243 Q160L probably benign Het
Cyp4a10 C T 4: 115,529,478 R441* probably null Het
Cyp8b1 T C 9: 121,915,234 E344G probably damaging Het
Dnah12 T C 14: 26,885,912 F3801L probably benign Het
Dnhd1 A G 7: 105,703,343 R2568G possibly damaging Het
Erbin T A 13: 103,834,062 E1015D probably damaging Het
Hist1h2ai C T 13: 21,716,486 A22V unknown Het
Ildr1 G A 16: 36,722,358 W417* probably null Het
Ildr1 G T 16: 36,722,359 D418Y probably damaging Het
Ispd T A 12: 36,390,498 L135Q probably damaging Het
Kdsr A T 1: 106,743,853 M142K probably damaging Het
Kidins220 T A 12: 24,990,728 V111E probably damaging Het
Ly75 T C 2: 60,349,940 E631G probably benign Het
Muc13 G A 16: 33,799,419 G179D unknown Het
Nebl T A 2: 17,452,552 T66S probably benign Het
Npsr1 T A 9: 24,310,081 I277N possibly damaging Het
Olfr352 T G 2: 36,870,340 I258S probably damaging Het
Olfr806 T A 10: 129,738,041 N292I probably damaging Het
Pcdha11 T A 18: 37,006,159 Y280* probably null Het
Pitrm1 T C 13: 6,549,660 I46T probably benign Het
Plxnc1 A G 10: 94,801,490 V1308A possibly damaging Het
Ppp1r9a T C 6: 5,143,491 probably null Het
Ptgdr A G 14: 44,858,922 M111T probably damaging Het
Rab3gap1 A G 1: 127,938,633 K850R probably benign Het
Rsf1 G GACGGCGGCC 7: 97,579,909 probably benign Het
Smtnl2 T A 11: 72,403,167 M188L probably benign Het
Snip1 G A 4: 125,066,825 V25M probably damaging Het
Spock3 A C 8: 63,355,311 D411A unknown Het
Sptbn4 C T 7: 27,372,296 R1581H probably damaging Het
Stard13 A G 5: 151,042,162 S1080P probably benign Het
Svep1 A T 4: 58,070,566 C2407S possibly damaging Het
Tanc1 T C 2: 59,806,307 S845P probably damaging Het
Tnfsf13 T C 11: 69,683,862 Y202C probably damaging Het
Top1 T A 2: 160,717,454 C632* probably null Het
Tsr1 C A 11: 74,900,270 T225K probably benign Het
Other mutations in Filip1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Filip1l APN 16 57572348 nonsense probably null
IGL01393:Filip1l APN 16 57572223 missense probably damaging 1.00
IGL01886:Filip1l APN 16 57571250 missense possibly damaging 0.47
IGL02336:Filip1l APN 16 57571733 splice site probably null
IGL02503:Filip1l APN 16 57571575 missense probably benign 0.00
IGL02608:Filip1l APN 16 57572106 missense probably benign 0.05
IGL02681:Filip1l APN 16 57571779 missense probably benign 0.10
IGL02687:Filip1l APN 16 57571127 missense probably benign 0.30
IGL02982:Filip1l APN 16 57572232 missense probably damaging 1.00
IGL03062:Filip1l APN 16 57506804 missense probably damaging 1.00
R1027:Filip1l UTSW 16 57569688 missense probably benign
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1347:Filip1l UTSW 16 57570987 missense probably damaging 1.00
R1384:Filip1l UTSW 16 57571289 missense possibly damaging 0.61
R1655:Filip1l UTSW 16 57571851 missense probably damaging 1.00
R1764:Filip1l UTSW 16 57570038 missense probably damaging 1.00
R1809:Filip1l UTSW 16 57506660 missense probably benign
R1983:Filip1l UTSW 16 57571274 missense probably damaging 0.98
R2504:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R2504:Filip1l UTSW 16 57571047 missense probably damaging 0.97
R3117:Filip1l UTSW 16 57506732 missense probably benign 0.07
R3844:Filip1l UTSW 16 57572427 missense probably benign 0.15
R3871:Filip1l UTSW 16 57513286 missense probably damaging 0.97
R4231:Filip1l UTSW 16 57506768 missense probably benign
R4391:Filip1l UTSW 16 57570792 nonsense probably null
R4700:Filip1l UTSW 16 57570695 missense probably benign 0.00
R4999:Filip1l UTSW 16 57570415 missense probably benign 0.01
R5002:Filip1l UTSW 16 57571103 missense probably benign 0.01
R5123:Filip1l UTSW 16 57570662 missense possibly damaging 0.76
R5294:Filip1l UTSW 16 57570036 missense possibly damaging 0.59
R5429:Filip1l UTSW 16 57570255 missense probably damaging 0.99
R5811:Filip1l UTSW 16 57570294 missense probably damaging 1.00
R6220:Filip1l UTSW 16 57569989 missense probably benign 0.31
R6452:Filip1l UTSW 16 57506800 missense possibly damaging 0.82
R6678:Filip1l UTSW 16 57569970 missense probably benign 0.00
R6700:Filip1l UTSW 16 57571248 missense possibly damaging 0.86
R7260:Filip1l UTSW 16 57570924 missense probably damaging 1.00
R7327:Filip1l UTSW 16 57570937 missense probably damaging 1.00
R7578:Filip1l UTSW 16 57513282 missense probably damaging 0.99
R7691:Filip1l UTSW 16 57572433 missense probably benign 0.00
R7950:Filip1l UTSW 16 57569711 missense probably damaging 1.00
R8288:Filip1l UTSW 16 57570554 missense probably damaging 1.00
R8334:Filip1l UTSW 16 57570147 missense probably benign 0.18
R8742:Filip1l UTSW 16 57571230 missense probably damaging 1.00
R9020:Filip1l UTSW 16 57570695 missense probably benign 0.00
R9157:Filip1l UTSW 16 57571617 missense probably benign 0.04
RF019:Filip1l UTSW 16 57570641 missense probably benign 0.07
Z1088:Filip1l UTSW 16 57513405 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTTAGGAGGCTCCAGGAAG -3'
(R):5'- TTAGGGTCGTCATCCTGGTC -3'

Sequencing Primer
(F):5'- CTTTAGGAGGCTCCAGGAAGAAGAAG -3'
(R):5'- CTCCTCATAGAACTGACCATTGATC -3'
Posted On 2020-09-02