Incidental Mutation 'R8393:Gpr45'
ID 647452
Institutional Source Beutler Lab
Gene Symbol Gpr45
Ensembl Gene ENSMUSG00000041907
Gene Name G protein-coupled receptor 45
Synonyms 9230112G11Rik, PSP24alpha
MMRRC Submission 067811-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.167) question?
Stock # R8393 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 42992032-43074611 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 43071395 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 13 (H13N)
Ref Sequence ENSEMBL: ENSMUSP00000135986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114761] [ENSMUST00000179766]
AlphaFold Q9EQQ4
Predicted Effect probably benign
Transcript: ENSMUST00000114761
AA Change: H13N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000110409
Gene: ENSMUSG00000041907
AA Change: H13N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 42 188 5.5e-9 PFAM
Pfam:7TM_GPCR_Srsx 45 340 1.9e-7 PFAM
Pfam:7tm_1 51 325 2.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179766
AA Change: H13N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000135986
Gene: ENSMUSG00000041907
AA Change: H13N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 42 189 7.1e-9 PFAM
Pfam:7TM_GPCR_Srsx 45 340 1.9e-7 PFAM
Pfam:7tm_1 51 325 2.1e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the G protein-coupled receptor (GPCR) family. Members of this protein family contain seven putative transmembrane domains and may mediate signaling processes to the interior of the cell via activation of heterotrimeric G proteins. This protein may function in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 T C 4: 106,617,390 (GRCm39) T239A probably benign Het
Adgrg7 A G 16: 56,582,477 (GRCm39) S258P probably damaging Het
Capn10 T A 1: 92,871,130 (GRCm39) D313E probably benign Het
Caprin2 A G 6: 148,770,650 (GRCm39) V448A probably benign Het
Casr A G 16: 36,330,566 (GRCm39) V256A probably benign Het
Cped1 A G 6: 22,222,465 (GRCm39) T742A possibly damaging Het
Cyp2c39 G T 19: 39,525,255 (GRCm39) R186L possibly damaging Het
Dazl A T 17: 50,588,294 (GRCm39) S294T probably benign Het
Dnah17 C A 11: 117,947,855 (GRCm39) V2982F probably damaging Het
Enpp3 C A 10: 24,702,139 (GRCm39) C71F probably damaging Het
Fam234a A G 17: 26,437,149 (GRCm39) C177R probably damaging Het
Fbxl5 A C 5: 43,925,433 (GRCm39) Y186D possibly damaging Het
Fbxo43 T C 15: 36,162,494 (GRCm39) T238A probably benign Het
Fcgbp A G 7: 27,806,815 (GRCm39) H2261R probably benign Het
Gm20939 C T 17: 95,183,207 (GRCm39) H148Y probably damaging Het
Gpat4 GTGTT GT 8: 23,669,498 (GRCm39) probably benign Het
Irf4 A G 13: 30,947,610 (GRCm39) D438G probably damaging Het
Kcnk1 T C 8: 126,751,964 (GRCm39) V190A probably benign Het
Klre1 A T 6: 129,557,025 (GRCm39) K42N probably damaging Het
Lmbrd2 C T 15: 9,178,437 (GRCm39) T499M probably damaging Het
Lrrc14 G T 15: 76,598,398 (GRCm39) G345C probably damaging Het
Matn2 A G 15: 34,355,748 (GRCm39) H251R possibly damaging Het
Mpnd A G 17: 56,323,568 (GRCm39) E477G probably damaging Het
Muc17 C T 5: 137,171,179 (GRCm39) V151I Het
Nckap5l A C 15: 99,325,050 (GRCm39) C484W probably damaging Het
Npas1 C T 7: 16,195,266 (GRCm39) S354N probably damaging Het
Or1e25 T C 11: 73,494,261 (GRCm39) L285P probably damaging Het
Or4k2 C A 14: 50,424,342 (GRCm39) E112* probably null Het
Or52ab2 A T 7: 102,969,668 (GRCm39) I17F Het
Or52e3 T C 7: 102,869,399 (GRCm39) V158A probably benign Het
Or5w11 T C 2: 87,459,197 (GRCm39) L14P probably damaging Het
Or6c65 G T 10: 129,604,304 (GRCm39) *313L probably null Het
Or8d4 T A 9: 40,038,360 (GRCm39) H299L probably benign Het
Pabpc6 G A 17: 9,887,435 (GRCm39) P372L probably damaging Het
Pkd1 A G 17: 24,791,621 (GRCm39) N1103D probably damaging Het
Prelid2 C T 18: 42,014,313 (GRCm39) C171Y probably benign Het
R3hcc1 T C 14: 69,942,890 (GRCm39) Q229R probably benign Het
Rapgef6 T C 11: 54,578,487 (GRCm39) V1003A probably benign Het
Rbp3 T A 14: 33,678,156 (GRCm39) H701Q possibly damaging Het
Resf1 A T 6: 149,229,998 (GRCm39) T1015S possibly damaging Het
Rmdn2 T C 17: 79,975,459 (GRCm39) probably null Het
Robo2 A T 16: 73,775,382 (GRCm39) W451R probably damaging Het
Sacs T A 14: 61,410,655 (GRCm39) M1K probably null Het
Senp2 G A 16: 21,850,864 (GRCm39) G294R probably damaging Het
Setdb2 T A 14: 59,650,180 (GRCm39) H478L probably benign Het
Slc12a4 G T 8: 106,678,451 (GRCm39) A295E probably damaging Het
Slc12a9 C T 5: 137,319,698 (GRCm39) V606M probably damaging Het
Slc25a30 T C 14: 76,012,451 (GRCm39) K66E probably benign Het
Slc39a6 T C 18: 24,732,331 (GRCm39) E319G possibly damaging Het
Sorbs3 T A 14: 70,422,360 (GRCm39) T617S probably benign Het
Speer4a3 A T 5: 26,158,076 (GRCm39) V92E probably damaging Het
Spef2 T G 15: 9,676,615 (GRCm39) D652A probably benign Het
Stag3 T C 5: 138,295,017 (GRCm39) M347T probably damaging Het
Tecpr2 A T 12: 110,911,191 (GRCm39) D1076V probably damaging Het
Tor2a G A 2: 32,651,648 (GRCm39) V288I probably benign Het
Usp30 C T 5: 114,259,826 (GRCm39) R511* probably null Het
Vezt T C 10: 93,832,704 (GRCm39) T236A probably damaging Het
Zmynd12 A T 4: 119,305,352 (GRCm39) D264V probably damaging Het
Other mutations in Gpr45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Gpr45 APN 1 43,071,452 (GRCm39) missense possibly damaging 0.77
IGL01528:Gpr45 APN 1 43,072,383 (GRCm39) missense probably benign 0.00
IGL01833:Gpr45 APN 1 43,071,402 (GRCm39) missense probably benign
IGL02034:Gpr45 APN 1 43,072,478 (GRCm39) makesense probably null
IGL02230:Gpr45 APN 1 43,071,816 (GRCm39) missense probably damaging 1.00
IGL02279:Gpr45 APN 1 43,071,998 (GRCm39) missense probably damaging 0.96
IGL02394:Gpr45 APN 1 43,069,272 (GRCm39) intron probably benign
IGL02795:Gpr45 APN 1 43,071,653 (GRCm39) missense possibly damaging 0.82
IGL02902:Gpr45 APN 1 43,072,371 (GRCm39) missense possibly damaging 0.67
IGL03017:Gpr45 APN 1 43,071,516 (GRCm39) missense possibly damaging 0.95
expansive UTSW 1 43,071,998 (GRCm39) missense probably damaging 0.96
extensive UTSW 1 43,072,218 (GRCm39) missense probably damaging 1.00
omnipresent UTSW 1 43,071,534 (GRCm39) missense probably damaging 1.00
R0368:Gpr45 UTSW 1 43,072,176 (GRCm39) missense probably damaging 1.00
R2964:Gpr45 UTSW 1 43,071,668 (GRCm39) missense possibly damaging 0.87
R2965:Gpr45 UTSW 1 43,071,668 (GRCm39) missense possibly damaging 0.87
R2966:Gpr45 UTSW 1 43,071,668 (GRCm39) missense possibly damaging 0.87
R4551:Gpr45 UTSW 1 43,071,950 (GRCm39) missense probably benign 0.00
R4681:Gpr45 UTSW 1 43,072,068 (GRCm39) missense probably benign 0.00
R4821:Gpr45 UTSW 1 43,069,613 (GRCm39) intron probably benign
R4966:Gpr45 UTSW 1 43,072,280 (GRCm39) missense probably benign 0.00
R5054:Gpr45 UTSW 1 43,071,809 (GRCm39) missense probably benign 0.38
R5319:Gpr45 UTSW 1 43,071,998 (GRCm39) missense probably damaging 0.96
R5667:Gpr45 UTSW 1 43,072,218 (GRCm39) missense probably damaging 1.00
R5671:Gpr45 UTSW 1 43,072,218 (GRCm39) missense probably damaging 1.00
R7250:Gpr45 UTSW 1 43,071,531 (GRCm39) missense probably damaging 1.00
R8117:Gpr45 UTSW 1 43,072,475 (GRCm39) missense probably damaging 1.00
R8752:Gpr45 UTSW 1 43,071,842 (GRCm39) missense possibly damaging 0.94
R8927:Gpr45 UTSW 1 43,072,314 (GRCm39) missense probably damaging 0.98
R8928:Gpr45 UTSW 1 43,072,314 (GRCm39) missense probably damaging 0.98
R9316:Gpr45 UTSW 1 43,071,534 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCTACCACAGAAACAGG -3'
(R):5'- ATAGCTGAACGCATGGCTGG -3'

Sequencing Primer
(F):5'- GGAAGATTTCTCCCAACGACTC -3'
(R):5'- GCCTCTGGTACACGATGATG -3'
Posted On 2020-09-02