Incidental Mutation 'R8393:Gpr45'
ID 647452
Institutional Source Beutler Lab
Gene Symbol Gpr45
Ensembl Gene ENSMUSG00000041907
Gene Name G protein-coupled receptor 45
Synonyms PSP24alpha, 9230112G11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock # R8393 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 42952872-43035456 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 43032235 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 13 (H13N)
Ref Sequence ENSEMBL: ENSMUSP00000135986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114761] [ENSMUST00000179766]
AlphaFold Q9EQQ4
Predicted Effect probably benign
Transcript: ENSMUST00000114761
AA Change: H13N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000110409
Gene: ENSMUSG00000041907
AA Change: H13N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 42 188 5.5e-9 PFAM
Pfam:7TM_GPCR_Srsx 45 340 1.9e-7 PFAM
Pfam:7tm_1 51 325 2.4e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179766
AA Change: H13N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000135986
Gene: ENSMUSG00000041907
AA Change: H13N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 42 189 7.1e-9 PFAM
Pfam:7TM_GPCR_Srsx 45 340 1.9e-7 PFAM
Pfam:7tm_1 51 325 2.1e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the G protein-coupled receptor (GPCR) family. Members of this protein family contain seven putative transmembrane domains and may mediate signaling processes to the interior of the cell via activation of heterotrimeric G proteins. This protein may function in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik A T 6: 149,328,500 T1015S possibly damaging Het
Acot11 T C 4: 106,760,193 T239A probably benign Het
Adgrg7 A G 16: 56,762,114 S258P probably damaging Het
Capn10 T A 1: 92,943,408 D313E probably benign Het
Caprin2 A G 6: 148,869,152 V448A probably benign Het
Casr A G 16: 36,510,204 V256A probably benign Het
Cped1 A G 6: 22,222,466 T742A possibly damaging Het
Cyp2c39 G T 19: 39,536,811 R186L possibly damaging Het
Dazl A T 17: 50,281,266 S294T probably benign Het
Dnah17 C A 11: 118,057,029 V2982F probably damaging Het
Enpp3 C A 10: 24,826,241 C71F probably damaging Het
Fam234a A G 17: 26,218,175 C177R probably damaging Het
Fbxl5 A C 5: 43,768,091 Y186D possibly damaging Het
Fbxo43 T C 15: 36,162,348 T238A probably benign Het
Fcgbp A G 7: 28,107,390 H2261R probably benign Het
Gm20939 C T 17: 94,875,779 H148Y probably damaging Het
Gm21671 A T 5: 25,953,078 V92E probably damaging Het
Gpat4 GTGTT GT 8: 23,179,482 probably benign Het
Irf4 A G 13: 30,763,627 D438G probably damaging Het
Kcnk1 T C 8: 126,025,225 V190A probably benign Het
Klre1 A T 6: 129,580,062 K42N probably damaging Het
Lmbrd2 C T 15: 9,178,350 T499M probably damaging Het
Lrrc14 G T 15: 76,714,198 G345C probably damaging Het
Matn2 A G 15: 34,355,602 H251R possibly damaging Het
Mpnd A G 17: 56,016,568 E477G probably damaging Het
Muc3 C T 5: 137,142,331 V151I Het
Nckap5l A C 15: 99,427,169 C484W probably damaging Het
Npas1 C T 7: 16,461,341 S354N probably damaging Het
Olfr1131 T C 2: 87,628,853 L14P probably damaging Het
Olfr384 T C 11: 73,603,435 L285P probably damaging Het
Olfr594 T C 7: 103,220,192 V158A probably benign Het
Olfr597 A T 7: 103,320,461 I17F Het
Olfr730 C A 14: 50,186,885 E112* probably null Het
Olfr808 G T 10: 129,768,435 *313L probably null Het
Olfr985 T A 9: 40,127,064 H299L probably benign Het
Pabpc6 G A 17: 9,668,506 P372L probably damaging Het
Pkd1 A G 17: 24,572,647 N1103D probably damaging Het
Prelid2 C T 18: 41,881,248 C171Y probably benign Het
R3hcc1 T C 14: 69,705,441 Q229R probably benign Het
Rapgef6 T C 11: 54,687,661 V1003A probably benign Het
Rbp3 T A 14: 33,956,199 H701Q possibly damaging Het
Rmdn2 T C 17: 79,668,030 probably null Het
Robo2 A T 16: 73,978,494 W451R probably damaging Het
Sacs T A 14: 61,173,206 M1K probably null Het
Senp2 G A 16: 22,032,114 G294R probably damaging Het
Setdb2 T A 14: 59,412,731 H478L probably benign Het
Slc12a4 G T 8: 105,951,819 A295E probably damaging Het
Slc12a9 C T 5: 137,321,436 V606M probably damaging Het
Slc25a30 T C 14: 75,775,011 K66E probably benign Het
Slc39a6 T C 18: 24,599,274 E319G possibly damaging Het
Sorbs3 T A 14: 70,184,911 T617S probably benign Het
Spef2 T G 15: 9,676,529 D652A probably benign Het
Stag3 T C 5: 138,296,755 M347T probably damaging Het
Tecpr2 A T 12: 110,944,757 D1076V probably damaging Het
Tor2a G A 2: 32,761,636 V288I probably benign Het
Usp30 C T 5: 114,121,765 R511* probably null Het
Vezt T C 10: 93,996,842 T236A probably damaging Het
Zmynd12 A T 4: 119,448,155 D264V probably damaging Het
Other mutations in Gpr45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Gpr45 APN 1 43032292 missense possibly damaging 0.77
IGL01528:Gpr45 APN 1 43033223 missense probably benign 0.00
IGL01833:Gpr45 APN 1 43032242 missense probably benign
IGL02034:Gpr45 APN 1 43033318 makesense probably null
IGL02230:Gpr45 APN 1 43032656 missense probably damaging 1.00
IGL02279:Gpr45 APN 1 43032838 missense probably damaging 0.96
IGL02394:Gpr45 APN 1 43030112 intron probably benign
IGL02795:Gpr45 APN 1 43032493 missense possibly damaging 0.82
IGL02902:Gpr45 APN 1 43033211 missense possibly damaging 0.67
IGL03017:Gpr45 APN 1 43032356 missense possibly damaging 0.95
expansive UTSW 1 43032838 missense probably damaging 0.96
extensive UTSW 1 43033058 missense probably damaging 1.00
omnipresent UTSW 1 43032374 missense probably damaging 1.00
R0368:Gpr45 UTSW 1 43033016 missense probably damaging 1.00
R2964:Gpr45 UTSW 1 43032508 missense possibly damaging 0.87
R2965:Gpr45 UTSW 1 43032508 missense possibly damaging 0.87
R2966:Gpr45 UTSW 1 43032508 missense possibly damaging 0.87
R4551:Gpr45 UTSW 1 43032790 missense probably benign 0.00
R4681:Gpr45 UTSW 1 43032908 missense probably benign 0.00
R4821:Gpr45 UTSW 1 43030453 intron probably benign
R4966:Gpr45 UTSW 1 43033120 missense probably benign 0.00
R5054:Gpr45 UTSW 1 43032649 missense probably benign 0.38
R5319:Gpr45 UTSW 1 43032838 missense probably damaging 0.96
R5667:Gpr45 UTSW 1 43033058 missense probably damaging 1.00
R5671:Gpr45 UTSW 1 43033058 missense probably damaging 1.00
R7250:Gpr45 UTSW 1 43032371 missense probably damaging 1.00
R8117:Gpr45 UTSW 1 43033315 missense probably damaging 1.00
R8752:Gpr45 UTSW 1 43032682 missense possibly damaging 0.94
R8927:Gpr45 UTSW 1 43033154 missense probably damaging 0.98
R8928:Gpr45 UTSW 1 43033154 missense probably damaging 0.98
R9316:Gpr45 UTSW 1 43032374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCTACCACAGAAACAGG -3'
(R):5'- ATAGCTGAACGCATGGCTGG -3'

Sequencing Primer
(F):5'- GGAAGATTTCTCCCAACGACTC -3'
(R):5'- GCCTCTGGTACACGATGATG -3'
Posted On 2020-09-02